Description :
From Genome Similarity Track
Location :
Scaffold_4:203644- 204659
Transcript NameFunction/comments
Aphin_H310_05265conserved unknown protein

Sequence
1015 bases(100 bases per row)
TGATGTAGGTTGTATCCCCATTGAAAAATTTGTACTCTTCGCCCATGACCACCCACTGATGATGTTTCCAGCCTTTCAGGTTCGTGTTTTATTGTGCGAA
ACCCATACGTGGAGGCTTGGGACATGTTCTCCAACCTCCAACACGAACAACCATTTTCCTTTCTTGACGCGAGCATTGGAACGCTTGTGTTGAACGACAT
TATTCATCGTAGATACAACATGACATGGTGGAAAAGATCCTGGGGGAAAAGTTTTGGACGAAAATCGCCGACCAGCGAGAGAGGAATCAGCGAACCGACG
GCAAATTTAAGTGCATCGAAGACATTTTGCAAGGCTTCAATGCAAACCATGCGGTGCTTCGGCGTACGTTTCTATTGTTCATGGCGCCGAACGATCTCTT
CCATCTTGTCACGGTTAATCAAGGATCACCTTGTTTCGTGATGTTCACTGTAGAGGTTAAAGAAGTTTTGTCGGAAAAAAGCACTCGTACGTTCGTCAAC
CCTTTGATTTTGTAAACAGTCTTACTTGATATCAACAGGATCCATACAAGGACCTCCGAGATATTCGTTTGCCGAGTCATTTCGGACCAAAGTCGGTGCC
ATGAGCCAGCGACAAAAGTACGGAGAGGCAAATGAGCCGACAGATAAAACGCCAAACTATCCGCCTGTCACCGTCCATGTTAAGAAGAAGCCCCCCAAGC
CGTCCGCAGCAACCAAGCAGTTGAAGACATGATCGATTATAGGATTCACACTTCGTTGCCACGGTTGGTGGCGGATTCTGTAAATAAAGCATCAGCGACA
CGATAATCCTCGTCTTCCATGTTGCGTTGAGCGCCTGAAGAGTTGACATTCGTCGCGACTGAACGAGCACCCGTGTTTAGAAGACTTTGCATTTCATTTT
CCCCAGAGAAGACAGCTCGGCGCGTGCGTGGCAGGCACTAAAGGAGAACGTGAGGGTAAAGAAGACAAAGTTGCAGATATGACATGCCGTATGTCATGGA
AGGATTGGATGGAAC