Description :
From Genome Similarity Track
Location :
Scaffold_2868:2036- 3625
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2868-snap-gene-0.2Aspartate aminotransferase

Sequence
1589 bases(100 bases per row)
GGACCACGCAAGGCCATTAACGGCAAAATCCGTATGCTGTGCCATTCAGCTGGCAGTGCGCTCGACGAGCTCAGCAACGATCTCATCATGGAAGGCAAGT
GCGTGTACAAACTCGGCCTCGGCCAATCGCCATTCCCCGTGCCACAGTGCATTGTCGACGAACTACGGTATGTCGAAATGTATGTATGCCCTGCCGCGCA
TACTCCCTTTCCCCCCTCAAGAGGCTAGGATCTGACATCTCTCCCAATCTGCTGGTAGTGCAAACGCTCATCAGCGAGATTACCTCCCGGTCGCTGGCCT
GACGGAGCTCTGTGAGGACATCGCCGTGTGGGGATCCAGTCGCCTACAGCTACCCTACACAAAAGACGATGTCCTCGTCGGCCCAGGCACCAAGGAACTC
CTGTTCGTGTTGCAGACCGTGTACTATGGAGACCTGCTGCTGCCGAACCCGAGCTGTACAAGCTATGCTCCGCAAGCCAACATTGCTGGGCGTAACATGT
TTTGGCTGCCGACGTATGCCGAAGATCGCTGGGTACTACGTCCAGAGGTGCTGGATAGTCATTGTGCCAAGGATCCTGGTACGCTTGGATGCTGCACGTT
TGATTCGCGTTGTCTTGGCTAACGCTTTGTGCGTATCATTGACTTGACCTCAGAGGCCCCGCGGATACTCATCTTGAACAGCCCGTCAAATCCCACGGGC
TGCGTGTACAACGAAGAAGAGCTCAAGGCTGTTGCCGACGTCGCGCGCAAGTACAGGATGCTCGTCATCTCGGACGAGATTTACTCGGAACTCCACCACT
CTGGAGACCACTATTCGATCTCTCGCTTCTACCCAGAAGGCACGATCGTGTCGGGTGGCCTGAGCAAGTGGTGTGGAGCCGGTGGATGGCGCATGGGGTT
TTGGCTCTTCCCAAGCAGCATGGCGTGGCTACGCAAGTCGATGCTGGTCATGGCGTCCGAAACGTACACGTCAGTCGCGTCCCCTATCCAGCACGCCGCT
CGGAGGGCTTTTGTCCCAGAGTACGTATCGCGCAGTTGGCTTCCACAGGCTCATTAGTAGGTGGCGCTCACAGTATGAGTCGATTGATTTGGTCTAGCTG
TATCGAGCTGACGGCATACAAGCAGAAATCATGCAAAATCCTCAAGATTATTGGCCTCTGGTGCCATTACCAGCTCCAGAAAATGGCCGTCGACGCCCAG
GCACCCGAGGGTGGGTTCTACCTCTTTCCGAGCTTTGCGCGTCATCGCAAAGTGCTCGCCGACAGGGGCATCACAACGGATGTGGAGATGTGCCATCGAC
TCTTGCACGACACGGGCGTGGCGCTACTGCCGGGTTCCGCCTTTGGTCGCAGCCCGCATGAATTGTACGCTCGTATCGCATTCGTGGATTTCAAGGGTGA
TATAGCCCTGTACCTCATCGAGAGCATGGTGCGTTGCCGATAGGGATCTCGTTTGGCTGACCGGAGGAGCTGACTGGGTACTCGCTTTTGTGTACAGGAT
AATCTGGGCTTAGAGGCAGTCGACTCGTTCATCCAGTCGGTGTGTCCAAACATTGACACCGCCATGCGCCGTCTCTCGTCGTGGATCGC