Description :
From Genome Similarity Track
Location :
scaffold_1200:2036- 3115
Transcript NameFunction/comments
g11157.t1 ABCA1 lipid exporter

Sequence
1079 bases(100 bases per row)
GGCAGTCAGCGGGAGTGGGTGGTTGTTCACAGTCAAGCTCACATCTGACGCAGCGATGGACGAGTCGTGGTTCGTGGTCATCAACCGGTACAAAGACTGA
TCCATGAGCGCCTTGAACACGACCGATCCGTGCGTCAGCGTCGTGTTGATCAGCACATTATAGCTGAAGACGTTGCTGTCTTCGTCCGCACGAACGAGAT
ATCCACCGAATTGGTCCGAAATTCTATCGGAGAAAGCCCGGTTGAAGATCTCCTCTGACACTTTCAACTGGTATCCCGTTGCATCGGTAGCATTGATACT
GGGATCGTTGTACACAATGTCGAAGACAGTGGGGGAGTCGCTGGAGTACGGTGGAGTTCCGATATCATCTTGACTTAGTGACACAATTGACGCTCCTGTG
TAGTAGCCACTGCCCAATGCAGTTTCACACCAGCTTCCAGAACTTTGCATGCAAAACGACGGGGCCAGCACTCTACCTTCTTCGCTCTCAAGACCCGACA
GCTTGAGCGCAATGAAAGGATCGTCGTTGGTGAGTCCTGCAGCCTTCAGAATGGATAAACCAAAGATCAGCCATGCCACTGGAAGTAGAAGTCCCACGAT
GAAGAGCTTTTTGTCCCTCCTGGCGATACGAAAGCGCTTTTGGATCATCGCCACCATTTGAGTCAAGAAAATCGATCGAGAACGTCCCAGTGGCAAGGAA
CTGCCAGTACGGTCGAGTCTATGGTAATGTCCGTCTGCAGGCTTGTCGCCAACGATTGGAATGCTGTCCTGACCCACAACTCCGTGCTGCTTAACACGGT
TCTGCAGCGTATGTTGCTGGTCTTCGTCTGCCACCTCCGCCACTTTGATGAAAACCTCCTCCATAGTCGTCACACTAATCCCGTACGACAGCACCTGCAG
CTTGCTGAGGTTCTCGTCCATTTTGTGAAACATCGCCGGGAACTGCGACGAGCTGTCAAGAGGCAACTGGAACGCGATCTCGGTGCCAACATTGCTCAAT
ACTCGACTCGGTGGGATGTACCGCGAGACGAAGTCAATCACCACCGAGTCATCGCAGTTCTCCTCCTTCACGATCGTCA