Description :
From Genome Similarity Track
Location :
Scaffold_124:203554- 204782
Transcript NameFunction/comments
Phyin_T30-4PITG_20152Putative uncharacterized protein

Sequence
1228 bases(100 bases per row)
ATGGTGAAGCAAGTGCATCAACAATCCCTCGGCAGCCACTGCAGTCTCCTCGAAGCATTTCAGCCATACGTGACCCGGTTCATTGTCCAGTGACGCGCGC
ATCTGCAAACCCAAGAACAGCAGCGGCATTGACATGCGTCTTTCAAGAGTACGCGCACGTTCAACTTCACGCTGCCACTCCCCATCAGGCAGTGTACCTA
CCAACGCCGCTTCGATGGCACTGAAAATGAGCTTCTTCACGTCCACATCTTGAAGCACCTCGGTCCGGTGCATGATCCAAAAGCGCAGACACTCGAATAT
CGCACTCGTCTTCTGGACGATCAAACGCAGCGCTGGGATATCTTGTTCTCGTTGGGCAGCTGTGGAATTGGATGGGGGATTCACTGGACTATTCGTTGAT
GCTGACGGAGCAGACACAGGAGCGTTTTGAGCTCCAGGCTTCAGTTTGCTTTTCAGCTTGCTAAACGCGTCCGTATTGTCGGAATTACTCTCCACGCGGC
TCGCCCTGGGGTTATCGCTCCCGCGGCGCACTGCTGAGCTCGAAAGACTGGTCCCACTAGTGAGACTAGAGCCAGTAAACGAAGCCGACTTGGTGCCGGA
TCCGTTGCCTTCACTCGACGTGTCTGCTGCACCCATGCGTTCCATCGCTGCCTGCACTTCAATGGAGGCCTCTTCCACCTGCTGCTGCGCGAACACAGCA
AGCGTCATGACTATCCGGGCCACAAGTGACGGCTCAAACGCATTAATCTCCTCATGGTAGTCCGACATATCCTGTAGAATTGTGAGCGCAGCCATGGAAA
TGGAAAAGTCCATGTTCTGACACACGTCCACGAGATGGACGACCCATTCGGACAAATGAATGGGGTCGATTACGTGTTCTCCGGTGTTGTCCGACTTCAA
GTTCATAACGACAAGGCAATAGAGTCCCCACAGCGCCCGCTTTTTAATGTTAACCACATCGGTAAACGGAAGCTGGGCGATACGCACAAGAATGCGCCCA
ACAATCACGTGGAAATCGTCTAATGTCTCTGGAATCTCGCCAATGATATCCTGCATCAACGGGAGTTCGTCAATGCCGCACACACCCATGATCTTCTGTT
TCCATCGCACAAAATCCTGGTCTGGGAACCGCTTGGGCAGTTCTAGAATAGCAAATACAACGTCCAATGCCGCATTCAGTTCATTGTTCCACTCAGACGA
CTTCACTTTGGACTTTTCAGCTCGACTC