Description :
From Genome Similarity Track
Location :
scaffold_60:203516- 210947
Transcript NameFunction/comments
g6727.t1hypothetical protein
g6728.t1 hypothetical protein PHYSODRAFT_349205

Sequence
7431 bases(100 bases per row)
GATCTCATTAGGTCCCGAAAGGATTATCGTTAGGTATTCCGCATTTCTCCGCGTTCTGCCAGCATGCTGAGTCGGAACTTCCGCACGACGTACTACAAGA
CGCTGGGCGTGCCTGTGGTGCAGCACATTGTGGACGTGGACGCGTCGTTCGCGGCGCTGCTAGGCGAGAGAACGGTGAACGTGCCGCAGCTGCTCAAGTT
GGCGCTGGAGTTGGGCATCGCGCCGCAGTACCGCGCGAGGATGTGGCTGCTGCTGGCGGGGGTGCTGCCGCCGTATCCGGGACTGTGGACGTTTGTGTTG
AGGGAGCGCCACGCCATGTTTGAGGATGTGGTGGGCGCGGCGCAAGTCCTGCAGGCGAAAGACGTGAGCGAAGGAGACGAAGGGGGCGGCGTGTACTACG
ACTTCTCGGAGCTTCTTGTGAAGGATGAAGACGATGCAGAAGATGAAGTTGCAGGGAAGACGCCACGACCTCCTTCGCTGCAGGATTTGAAGAGGCTGGT
GCACTTGCATCGAACATATTGGAGAGAGATCGCGGCGTGTGACGCGCCGTTGTTGTGCGGGATGGACGACCCGAACTTCTTGCTGGGCGTGGCTCGAGTG
GTGTGTGAGGTGCTGACACAGGCACCGGAGCGGTTTTGGTGCTTCACGAGGTTGCTCGAGTTGTTTCATGATGGTCTGGAGCTTGTGGATCCGATGGTGA
CGGTGGACACGCTGTACAAAGCACAACTGGCGGACTTTGAAGCCGTGTTTCTCCGTACACTCGACGTGAAGCGACGTCGTCTGACTGCTGACGGGTCCAT
CTCAAGTATGCACGTGCTCAAGAGTGGCCATGATGAGGAGCATGGGCGACGACGGTAAAAATATCAAATAAGCTGCATGGTATTCAAAACAACCAATCCC
TCATGGTCAGTTAAGCAAAACCTTCGACGTTCTCGTCCTCATCCGCACTATCGCTCTCTGCGACTTGCTGCTTGACAGCAGCCCTGCGTGAGCGACGTCG
CCGCTTCGGTGGGGTCTTGAGTTTCAATTGTCGTTCCTTGGGTTTCTTCTCCGTTTCCAGATCGAAGTCCAGCTGCGCTTGGTCTTTGCGAGCTACGAGC
CACGCAGTCATAAAAAGATTCCAGTTAATCTGGATAGGATCTTCCGCGTGAAAGAAATCGTCGACAGAAGGGAGCAGGAGTTTCTTGGGGGACCGCTCTC
TCACCTCTACAGATTTATCTGCCGTAGAGTGTTTATACGTTGCGCACTTTTCGTTGTCCAGCTTGTAGTTGGCCTTCAGCGCAAGCTTCAGATGGAGCAT
CAGTGCCAGTGCGAAAGCAGTGCACCCGTTAGTCTCCAGAGCTGCCAGCTCGGAGCCGGTTAACGGAGATAGTGGGCGGTATTTGTCGATATCAACTTGT
GAGAGGTTAGATTCGTCGTCCTCCAACTTGTCAGCCGCTACACCCGCCTTCGCAAACGTTTCCCTGAGATCGTCCAGCACAGGGCTAACGAATAAAATAA
AACGAAAACACCAGCGGAGTGTGAGATACACGCACGCCCTAAAACTTGACAGGCTACTACATGTACGTACCCGAGACGAAGGCTCGCATAGCGGTTGATC
AAATAAATAATGTACAGCGGCTCATTCTCCACCTCGTACGGTAGCGCGGCAATGATTTGTGCCAGGTAGCACAAATATTTCAGATTGCCCACGGTGATGC
TGCTGTTGGCGGAGGCAGGTTTGTTCTGTGTCTTTAGAACGCTTCCCTGGGCAGTGAATTGATTCACGAGCGCCTGAAGGAAAACGAATCTCGTTGACTT
AAGGCAAGTCGTGTACAATCGCCCGAAAAGACAAAATTCTTTGTTGTCTTTCTCGTCCTTCTTGGGCCTCGAAGCTGTAGCGGTGCCGAATACTCTCAGT
TGAAACGAGTACGAGTCCCGGATGCCTTTGATAGACGGCGTGAGGAACTGGCTTGGGAACCTTTCATACACCGCCAGCAGCTGAGAAAACGCAGCATCTC
GGACGCCCAACACGCCATCCGTCTCCAACGCCACCAAGTTCGGAATGCATTGCAGTGGATTCACTAAGCCTTGTGTTAGTAGTGCTCCAATGCACCCGAC
CGCCTCCTGTCGAATTTGCGCTACTTTATGCAGCGATAACAGCAATACATTTCCTAACTCCGCTTGCATAACGTTGCCAATCAACGAGGCGTCAGCTTCC
TGGTCGCCTTGAACTTGCTGTTCTTTGCTTTTGGATCGATCCATCCTCTGCGTCGCCAGTCCATTTCCCAGTCGCTGCTCTTCGTAAAGTAACAGCTCCT
TCATGCTTACAAGGCAATGCAACGTCAACTTGCCAGGTGCTGCAGTTAACAGAAACTTCAACAGTCCATCTTGCTGAGCCCGTAAAAACAGACGCGGTCG
AATAGGGAACAAGAATCCCATGCCTTGAACAGCTTTACCGGCGCATGCATCATTGCCTGGCTTGCGAACATATTCTCTGTACCACTCATACAGCAACTCT
GTGATCGCCCCAATCTTTAGCAGTTTCGCTTCATTTGTCAACTCCTTGTGACGGTCAATATCCGTCGCTCCCACTATTTTTCCCGCAGCAAACAGTGCTC
GCTGAAGAACATAATTATCTTTCTCCGATAAAGTGGTAAGCGACTCCTTAAGTTTGTCCCGCATAATTAGGGAAAACTGCTCCAGCAATTTAAGGAGCAA
TACAGGAGCCATTTTCCTGGTTGAGGACAAAGTTGCTAGGCACTTGACACTCGGATCAACGACACTTGGGGGAGATCCCAGCACTAGGAGCCTCAAATCA
TCTTCAAGCTTATTAGCAAGAGATTGTGGGGGCCTCTTGACACTCAAAATGTGGTCAATCATTGACACCGCGAGCCTTTGGATCTTGAAATCGTCCTCTT
TCAGGTAAACCCGAAGAGTCTCGATATGACAAGCCAAAATTTGAGGTTTTGCTTCACAAAAAGCAGTCAAAGCCTTCATGCACGATACAAACTGCAAGTG
ACCTTCTTCTATCGAAACACCCTGGAGCAGTTTACCTTCCTGGAGGTCCATGAGGCAGGCAACAAGTCCGCCGACAATTTTCTCGGAGCGATCTTGTGCA
ATTTCAGCTTCATTCTTACTCGATCGCGATACCTTTTTTCTCGTGCTGTCAGTACGTTCCTCCAGCAGCCGTTTCAACAATTCAACGAACCAGCTAAAGT
TTGGCATGCCATGGATGACTTCAACGATAGTTGCGACAACTTCTGACGTATTATCCATCTTGGAGTCAATAATCTTTACCACACTAGAGGGAGCCACAGT
AGGAGTTCGATACGCAGACCACGCTTCCTCGACTGAGTTGGCGATGTTCCCGCCTTCGGATACAAACTTCACATTTTCTTGCGATATTGGTGCAGCAACA
CCCTTCTCGTCACTTGTACTCGCAACAGCTGCCCATCCAGGTGGAAGATTGCTTCCATCACCAAACTCGCCGAGCGGGTTAGAAAGTCGGGAGAAAGCAA
GCTCGGCACCGAACCAGACTTCTTGGAAAGTGTCAATGATGAAGTTCTTCACGCCTTGATCTTCAGCTGCATCTCCAATTCGCTCAACCAGGCACTTCAT
ACAAGCGCTCTTGCGGCGGAGCTCTTGCTCCGAGATTGCATCACCAGACCGATTTTGCATTGATATCAACACTACCTTGAAGATCTTGCACACACTTTTG
CGAACTTTAATACCTTTGTCTCTTAGCCTCTCTGCAAGTGCGTCGAAATATTTGTCGAACTGTTCATCAATGAAAATCACCACCGTTAGAATTAGAGATT
GGGTGGATATTGGACATAACGAGCACGAGTCTTTCGTACCAGAAGGGGTTGCAGCAGAACGTAGGTCCCAATTAAATCCACGGCAGCTTCACGAACTGAA
GGTTTTTCATCAGAGCAGCACATCTGAACGGCTGTCTGCACACCGACTTCGGCCATAAGCATGGGATCGACGTCGACAATTCCTCGCAAACACTTCATAA
CACGCGCTCTTAGCGTTGGGATTCCCTTGGACAACAAAGCCATGACGTGCGCAAGCAAGCTGTCAAACAAACCGCAAAATCCACGTTTTACTGCAAGATG
CAAACTCGATTTCAACGCCAACTCATTCGTAGGAGCAGCCACCTTAAATATCGAGCCCACACCTCCATTTCTCATTTCCCACAAAGAATCCCATAATTTT
CTCTCTCGTTCTCGATAAACTGACTCGGCACTGCCCCAATGTGTGTCCAACTCCGACATGAACTTCAAAAGAAGCAACTTCTTTGAATCACTCTGACCAA
AGTTGTGTCGTTGAAGGTGCATCACCACGATATGCTTCAGCGCCATCTGCTGACACCATTGTATGCTAGCTCTCGGTAGGGCACTTCTGGACCGCGTTTT
CTTCCCAATTATTGCTGTGCGCAGGGTACTCATATGCTCTTCAACGATCGCAACAGCATCACTGTCATCTTTCACACCACTATGGCCGACCTCTTTCTGG
TATCGCTTGATTGAAGCGCACATCTTCCCGACCAAGTTAAGTGCAGCCAGGCTGTAATGTGAATCTGGGCTTTTACCTTCCTTGGAGATATTTGCGTGCA
GGATACTTGCCAATGAGGAGCTCAACACTTCGAGGAGCTCTTCAGCGCCTACCCATTCCGGGCGCACAAACATTTCCAGGAGGTCTTCAACAAAGTTATC
CAAGACCACGCGGTTGTCACGCTCTTCGGACCTTTTCCAGCATGCTGCGAGCAGCTTCCCAACAAACGACTGCGCGCTCTTTCGTGTTTCGTCCAATACG
GCCGCCACGGTACCATTTTGCTGCTGAGATTTTTCGTCAGTGACAGTATCTGGTGTCGACGAAGGTTCTATTGAATCGTTCAACAATTCAACGTCAGCTT
CCGCTGTCCCAACTTTGACAGCTGGCGCGCAAGACTGAATCATGGACACCGCTACTGTTGATATTTGCTGCACCATTTCGACTGAGTTAAGTAACTTCAT
TGTTCGCAGCGTACGCTTGGTAGTAGGTAGCTTTACCATGACTCCAACTATATCGGCAAGAAGTGAGTCTCGGTGAGTCGGATACTGCAGGAAGATGTTT
CGAAGCACTACAAGACCACTTTGTTGTAACGACGTAGCATATGTGCTGTACTCCAGAGTAAACAACTCAACCATCGAAGAAGACAGAGGTAATAACCACC
GGTCAGCAAGTTTCACACCTAGCACAAGTGTTGCGAGGTGATCCATGAGCTCACACACGACGTGGGTAACCCCGCTAACAGCCTCACGAATGTTTTTGTT
GGTACGCAGATTTACACGAGAAGAGCTCGATGTTTTGCCACCCGTTGACCGGCTCTGATACTTTTCATTTCCCACTCTTGCCGATGCAGTTGTTGCAAAT
GTGGTATCAATGCACGGAAGTAGCAGCCGACGAATAATGTGATGCAAGAGCAAAAAACAGTTGTTAATAGTCTCCTCGGAAAGAATTCGGCGGTCAATCT
GCGGTGTTGTCATCACAATCAGCTCACAAATGGCGACATCGAGCGATGCTATGAGACGTTGAACTAGTCCGTCGTTTGGCTTACAGAGATGGGACCTTTT
CTCTTCATTGCTCGGCATCATGGCGGCAAGTACATCCAACGTCAAACCCAGTTGCACCTGCGTATCAAATGCGCTCATCAACGAGATCAGCAGCTCTGGC
TCCAACTTATTAATCCAATCATTATTTTCCATGGCTTTCAGTGACTGCAGCAGCAACTTCACTTCATCTGACGAGAACACATCCTGGTCACCCAGTTCAA
AATCTTCCTGCTGTTGGCGATACATGGCCACATCAACCAATTTCACCAGTAGCTCAGCATACTTCTCCACACTGTAAGCAGTAATCTCCGCTTGAGTAGG
AAGTGCTGGGGTCTCTGCTTTGTCTTCCACCTCCACATCCACATCGTGCTCGGCATTCAATTCATCCAAACAATTTTGCAGCTCGCCACCTTCATCGTGC
ATCGAGCTCATATCATCTGTAGTGTTTCTAACTGACTGCCTCTTACACGGTTGTTCGTACTCCGTCTCATTCTGCAGCTCCAGACGTCTCTTCAACTTGT
TCGACGGTGATGCTTTCAGACCACGCGCAGACTCAGCTACATGTAGCAGCGTCCAAACACATTCACCGTTAGGTCCGCATTAGCAGTAATTGTACTACTA
TACACAGCTCTTGATTCTCGACAAACCATTGAAGCATCCCGTCTGCACCACCGCCTGCGCCCACTTGGGCATCGAATTTAGCACATCTGCGTCGATTTCC
GTCGTCTCACCCACAGTACTGCAATATTCATCGCCAATTCACAACAAATGCCACGTTAATGCATATTATTTACTATACATACTGAAGTTTTTACTGTTCG
TACCTGAGTCTGCCGGCGTTGGCAGTGCGGATAAGCGTCGCCATCCGCTGCGGGTTGAAGGTCTCGGCGCCTGCCACGGGCTCCGCAGCCATAGGATGCA
CCATCTCGCGCGCATCGGCCGCCACCACGTCCTCCGTGTCCACGTACAGTGGGAAGAGAAACAGCCCACCCTGCATCGTCCTCGGCGAGAGCACACCCTT
CTCTGCTTGTTAATGCGGAATGTGAGTGATTGTTTCCTTTGGTAGAAATGTGGTGTATGGTACACCACGTATCTGCTGTCATTTAGAAACGACCTAACCT
GCACTTGACGATGGATAAGGCCATTAGACTTAAACTGCAACAATTGCAGTCTTACTCGACTTTCTGGCGCGGCCTGTGCGCCGGACGCATTTTCCTCTCA
CCAGACGAGAGAACTCCTGAGCGGAATATGGCGCATAAGATGCGGACCTGTTGTCGTCGTGAGCAACGTAAAGTACATGTGCGTTAGCACCAAAGATCAC
ATGAGGCAGAAGCATGAATATATATATAAAGAGCATCGCTCACAATGTTCCAGACCCAGATGCAGTGCAGAAGCAGCTTGATCGTAGGCAATGGAAGCAC
TTCTCTGGCTCCAGCGAGCCGCTTGACCGGCACGAGAACGTCTCCGTACAGCACTAGGGCTGACACAAACAGCACTAAGCGGATAAACTGTGCCAAAGTC
CGAGTCAGCCGCATTTTCAACGTGATATGCTTTAAAACCTCAACGTACCAGCGCAGTACTGCGGAAATACACCAAGAGAGTTGCGGCTGTTGCTCCCAAG
CGCACCGCCTCCGGTTTATCGTAGTCTAGAGTGCAAGTCACCCCCAGTAGCGCGACCAACCCCTGCATCGAAGCTGTTAGAACCGGCAACAACCAGGCGA
TCCCACCAGTGCGCAGCGCAGAACCCTACCAGTTGGATATAGATCGCGACGTCAGTTGCTCGGGAACGACCAGCAGTCGATGCTGGTCCCCACAGCGTAC
GGTCCAAGTCAGTGTGGTGAAGCACTACCAT