Description :
From Genome Similarity Track
Location :
Scaffold_2090:2035- 6054
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2090-fgenesh-gene-0.1MSP domain containing protein
Pytar_ATCC12531maker-par_contig_2090-fgenesh-gene-0.2Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_2090-fgenesh-gene-0.0Nucleolin

Sequence
4019 bases(100 bases per row)
CGTCCGGATTCGCCCCTTCGACAAAGCGGCAGCGCAGTTTCTTGTTCGCGAGGCTCTTCTTGTCGGCCTTGGCCCACATATTCGTGAGCTCGTCGGCCAT
TTCCTTGGGCGACTTGGTCTTGACGAGCTCATAAAAGCTGTCGTCGACGTAGCTGCTTTGCACGAGAAACTTGTCGTTCGAGAGCGATCGCTCCGACGGA
TCCAGCCGCAAGAGCTCATCGCAGTCCTTTTGCTGCAGAATGACCATGACCGACGCGCACATGTTGGGCCCGAGCATGCCCTGGTTCGGGCGCACGAGGT
ACCGCAGAGGACGCGTGGTTTTCACCTTGAACGCGATCTTGCGCGTGTCGGAAATGTTGCGGATGAGCAGCACGGCCTGCGGCGACGCCGCTGGCTGCAA
GTGGAACGTCAGCGACTCAACGGGATCCAGCACGACGCTCGAGGTCGGCGCGTCTGCATTCGAATCGGCCATAGTGACGGAGATATCTAGTGAAGACGAG
AAACGGACTCGTTCGTTAGTGACGCACGAGTGGGCCAACTTCAAACCGCGATGGCGAGCGAACGAGAGCGAATTACGGAGGCGTACCGACGTGAGCGGAC
TGTACAGCGAGTGGCGAATGCACGAAGGAGAACTGGTGGTGGAGGTCTCGCGGAGCCGCCGCGTGAGAGGCGATGGGGAGATGTGGCACCCTGTCCCCCC
GGCTCGTCGTTCTGAAGCAGGGCTTCCCTTTCTTCAGCTCACGACGAGAGAAGAACGGTCGAAAAGGGGTCGGGAAGGGTGAGTATTGAATATTCTGGAA
GATTGAATGGCTATTTACGTAATTTGGCTAATCTATGTACCGCAGAAATGATATTATTCTGTGGTGAGCTGGCAGTGTAGCCATGTGCACTGAGAATGAA
ATGAAGCAGAAGAATGGAAGGAATGATCGCGGTGTTTCATGCACACGTTCGCAGCGTATTAGTGGATATATGCGACCCCATACGAGTAGCCCCTTGTCTC
TTATAACCGCCCCCCTCTATCTACACCTGAGCAGCGTCGTTCGGGATGATATTGGCGTAAAACTTCTGAAGCTGCTGCATCTGGCTCTCATACTCGTCGT
CGGGCATGCGCGCGACAACGTCCGCGACCGAGTTGAGCAGCGTCAGCGCGCGCTCGTACTTCTGCGACTGCGAGGGACTGTCAAACTTGGGCGACGGCTG
GCGCGTGAGCAGCGCCGAGGCCATTTGTGTGCGGCGCATGTTCTTGAGCAGCACGTCCGGGTACGACTCGTAAATCTCCTTGCTGATCGGGTGGTTGTGG
GTCACCACCTACAGAAAACAAACACAGGGACAGCGTTAATCTCATCGAAACGTCTCTAGGAGTGGGACAGGGTTGCAGTGCGGTACCTGGTCCGTCACGA
TGACCATGTACTTGTTCGGGTTCTCCGACGGGCTGATCTTGACGTTGATCTTGGCAATGCAGCCAATGCCGCGGTACTTTTGTCCGGGCCGCGTGGTCGC
GCCGCGGCATCGCGCCTTCATGGCATGGGTGCACATGTATATCCGGTGGTGGTGGATCGCCGAGTCGGGAAACTCGATGCGACGGCCGCGCGAGTTCTTG
TTGTTCATCATGACTTTTTGCTGGTTGCGGCGGTACGCCTCGACGCTGCAGGACGAGCGCATGCGGAACGGCTGGAACGTCTCCTGCATGTACATTTCAA
AGTACGCGTCGAATTCGTACCACGAGTTGAACGACACGCGGCTCATGCGCTTGCTGTCGTAGAGCTGCACGCGCTGGTCGCCATTGCGCGCGACCATTTG
GCCGCCGGCGCCCGCCGTCGTGTGGAGCGCCGCCTCGTTGGCTTCCTTCATCTTGGCCATGACGTCTTTCATCGCGTCGTCGTGCTCATCGTCGTCATAC
TCGTCATCCTGGTCGCCCGCCGCATCGTCCGCGACGTCGTCACTGGACGTCGCGCGCGCCTTGCGCTTCTTCGGGTCGCTCTCAAGCGGCGCATTGACCA
CGGCCGCCAATGCGACCGGATCTTGAGCGGCCGCCGCCACCGCCGCGGCCGTAACCGCCTCTTGCGCAGCGAGAGCAGCGGCATCCGCGATGGCCGCATC
CGCGCTGGTGGCCACGACGGCAACGGCGGGCGCGGAGGCAAGCGCCGCCACTTCCTGCGCGATGGCGGCAGAAGGCTCAGTCATGGTGCTTCAACTTGCG
CTTGGCTTGTGTAGACTTGGTGTGGCTTGGGATTCCTTTTGGTGTGTGCGTTGTGTGGGCCGACGGCAAGCGGAAGGAAAATGGAAACCACACCATTCAA
AAAAAGCCCCCATGCAGGAAAAAACCTTATTAGTGAGGTTGTAGTGATGAAAAACCTCGAGGTTACACTGTGGTTGTAACCCAACCCGCTCTGGTTGAAA
TCCCGTTATATACTGGCGCAGCTGTCCCACTTGCGTGACACTTGTAACCAAGCGAAAGGTTGCACGAAGGTTGCGTGAAGGGCTTCGGCTGGTGGCAGCC
AACCAAAGCGCATTGAGATCAACGACGTTTCAACCTCCACTTGGTTGGCAGAGCTGGTGGCGAGCAAGCGTTGGGATCCGCGATATTTCGAATCGCCTCA
TTCATCAACACACACACACCGTCCACGATGGCGAAGAAAGCTCCAGCCACCAAGAAGCAGCAGGCCAAGCCCGCGAGCAGCAGCAGCTCGTCGGACGACT
CGAGCAGCGACGAGTCGGTCAAGAAGGCGCCGGTCGCCGCCAAGAAGGTGGTCGCCAAGAAGGAGGAGAGCTCGGACGACTCGTCCTCGGATGACTCCTC
GGATGACGAGAAGAAGCCGGCACCTGTGAAGAAGGCGCCTGCCACCAAGCCCGCCGCGAAGAAGGCCGAGTCCTCGGATGACTCGTCGGATGATTCGTCC
GATGAGGAGCCGGCCAAGAAGCCCGTTGCCAAGAAGGCCGCGCCGCCTGCCAAGAAGGTTGCTGCCAAGAAGGAGGAAAGCTCGAGCGACTCGTCCTCGG
ACGACTCTGACGAGGAGATGGAGGAGGCCCCGCCCTCCAAGAAGGCTGCTCCTGCTGCCAAGAAGCCGGTCGCGAAGAAGGAGGAGTCGTCAGATGACTC
GTCGTCGGACGATTCGTCGGATGAAGAAGTGGCCAAGAAGCCGGTTGCCGCCAAGAAGGTTGTCAAGAAGGAGGACTCGACGAGTGACGACTCGTCGTCG
GATGACTCTTCCGACGAGGAAGAGGCCCCGGTCATGAACAAGAAGCGCAAGAACTCGGACGCCGAGAAGCCTGTCGCCAAGCTCCAGAAGCAGACCAACG
GCGCCGCCGCGGCTACGAATGGAGACGCTCCGGCATCTACTGAAGTGTTCATTGCTGGCCTCCCGTGGGCCGCGACGGAGGACGAGGTCCGTGAGAAGTT
CGCCGAGTGCGGTGAGATCACCAAGGTGCACCTTCCGCAGCAGAACGGCCGTGCCTCGGGCAACGCGTTCATCACGTTCGACTCTGTTGCCGCCGCGGAG
GCTGCGCTTGCCATGGACGGTGGCGACTTCAACGGCCGCTGGATGAAGATCCGCACCGCCGAGAAGAAGCAGAACTTTGAGGAGAAGCCTGAGGGCTGCA
CAAGCGTCTTCATCGGCAACTTGTCGTGGGACGTTGACGAAGACACCATCCGCCAGACGTTTGCCGAGTGCGGAGAGATCTTGAGCTGCCGATTGGCGAC
GGACCGTGAGACGGGCGAGTTCCGTGGATTTGGCCACTTGGACTTTGACACGACCGAGGCGGTCGACGCCGCCGTCCAGCTTGCGGGCTCGTACGTGAAC
GGCCGTGCGATTCGTGTGACGTACGCCAAGAACCGCGAGCAGTTTGGCGGTGGTGGCGGTGGTCGTGGCGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCGGTGGCTTTGACGGCGGCCGCGGCGGTGGTCGTGGCGGTGGTCGTGGTGGCTTTGG
TGGCCGTGGTGGTGGCCGT