Description :
From Genome Similarity Track
Location :
Scaffold_165:2035- 5329
Transcript NameFunction/comments
Hyaar_Emoy2811634vacuolar membrane-associated protein, putative

Sequence
3294 bases(100 bases per row)
GCAGTCCGAACGCCTTCATCCGCGTCTCGTGCTGTCGGTCGAGTCCCTCGCCCCCGTCCGTGGTAAAGTCCAAGTGAGTATCGCACGGGACATTGCCGCC
CAGTTCGGCCTTGAACCGTTCCGGGGCGTGAGTGTGCGACGTGTGCAGACGCAGCGGGACGTGGTCGTGGCCTTTGTCGAATTGAGTTTCAAGGACCAAT
TCCTATCGAGAGCTGACGTGTGGCGGTTCAAAGTCACGATGCTCGGCCACTGCGTCTACGTCGGCCGGACGGTCGAGTGCATTGGCATCCGGGGACAAGT
GGACGCGATCTTAAGTCCCAGTAAAACCCACGTACTTTGTGGCGTCATTGGGGACGCGACCAAAATCGTTGTCCGGTCGAGGTCCAGTCGACTCTTCTGG
CTCGTGCAAATGAGCACAGAGATGTGGGAAGTGGCGCCAGAGGATGGACAAGTGTATTGCGAAAAGATGCTCCATGACTTCTTGAGTGTACAAAGTCGCA
AGTGGACCGAGAGCTCTGTGAGCCACTCGGTCACGATCATGACGTTTTCCAGGACGTTTTACGACGTGGACCAGTTCCCTGATGGATTTGATCCTACACG
AGCGCCGTTTGTTGACCCTCGACGACAAGGCGTTGGGCCTGGATGTGGTGCACCAGGTGTCCATGTTGCTCAGGGATATGGTCCTACAATCCATGTTGAC
CCGGTCTCGGGTCGGTACTATGAGGATTTCTACAAGGTGGTTGTGATGAATTTTACGGGACCGGATTGGAGTCGGCTGCTGTTGCTTCTCAAAAAGGAGT
TTGCGACGTACTACGAGATACATCGGTGGCGCACGCCAGAAGAGAAATCTCCTGCACATTATGAAATCTGTCGGTGTCCAAAACAAGCAAACGATGTGGA
CAGAGCAGCAGCAGCAACCACAATAAATACTGGAGACAGAGAGTGTGCAGATAGTGAAGACGTTTACGTAAAATGGACAAAGCTGCCTTGTGGAGTTCCG
TCGCGAGCCAAGGATGGCAATATCTTGGAAGCTATCAACGTGACATTGAATGTGCTGGACAAACATTATATGGATCGCGACCTTTGTCGCACTGGACAGG
GTGTCGTCATGATAACAGCCGGATGCAGCATTTTCGACGTAGACAGTAAGCTTGCCGAGATCACTGAGCAGCGCATGATGGACAGCGGTGTCGGCATGGA
CATGATCTCGTTGTCTACGCCACCGCTGCACGTGGTTCCGTTGTTCATCTACCGCGACGGGTTACTTGCAAAGGCGGCAACAGCCAACACTTGGACACCA
AGTTCTTTGCACAAACTTTCTTTTCATAAAGTCCTAGGCGAAGAACTGATGTCTTTTGAGGATGGGTCGCCCTCCCATGGCATATCCAGCTTGCACTCAT
CTTCCCTACCTAAGACATCCGAGTGGGCGCAAGCTGGCAGCACCGTTCTGCGTCGAACGCTCATGTCAGCAGCACGCACCACTGCCACGGCGGACCGATC
CAAAGACTCAGGAGAGAAGCTGACGTATGATGTCCCGCATTGGGTGAATCTTACGTTCTTGGAGTTTAGTTGCAGCTGTGAACAAGCAAGCCACAACTAC
AGCTCAGCTCAGTCACCGGCCACATCAAACTTAAATCAGCACGGGCCACACGAAAAGCAAAGAGGCCGTGCCTGGCATTCATCCTCGTGCCAAACCAAGC
GCAACCAGCGCTTCCACCCGTTGCCATCATTTCGGATGTTCGACATCACTTCGCCATCGGAGAAGCTGGTTTTTCCGGCTATGCTGCGGAACTTAATGCG
CGGAAAATCGAAAGATGGGCCTAGTAGTGGCAGTGACACTACACCCACTAGTATTCAGCGCGATGAAGAGGCTGACTGGTCGAGTGACAGTGTGAATGGA
GGAGTCTCTGTCTTTGCCAACGCGATCGCGCCAATTAAGAGTCTAGGCAATCAGCCCCAGCTGTCATATACAGCAACCAAGCTTCTCGATCCGATAGCGT
CAACACCTCCGTTAGAACAATTGCAGCTTAGTCGGTCTCCGGATTTTGACCCCGTTCTTGCCTCAAGCCAGTTATCTACTAATCTGAGTGGCAGACTCCA
CATGCGAGCGGCGTTGACAGCTTACGATGAGAACGTATTCTCGCCAGTGGCGCGGGACAGTGGATTTGCTGCTGATCGACCTTTTCGTGATCGACGGCTT
GGTTTTGCCACCCCTGGAATCAATGAAGAACACGACGATGTCACCAGCGTCACTTTTGCCAACGATGGTCGTCTCGAGTGGTTTCTTCGTGATGTAAGAA
AGGAAGCTGAGCAGCGCAGTAGTACTGGCAACCTGGGCAGCTATCGAAAAGGCAAAAGCGTGTTTTCCGGTGATAATGACAGTGTGGTCCAGACGCTGCT
ATTGCCACGAAAGCTTTCGAATAATGCGCTCACGGTCGGTCGGGCAGACCGCAGCGTTGCGACAGCACCCCGTCCACTCTCAAAGGACGACACAAGTCTC
ACATGCTCGCTTGAAGTGCCGCTTGCTAATTCTATAGACCGCAGTCGGTACGGTATGCCATTGGAAAAGAGAGACAAAGACTTTCGACCTACTGCACACG
CTGCAGCCAAGATGAACGATTTACAGTCAACGTTCGGTCCCTCACCTGCTGTCTCATCGCCACCAGGATCAGATGGCTTCATCGGTAGGTCAAGGAGCAA
TCTGCGGCAATTCAGCAACACAGGTTCACCTCTAGGTTTGCGTAGGAATCAATCCGACTTTTTCAAAGCACCGCTTGTGCCTGGAAGCTTGAGCTTTAAG
GCATTATTGGGAACGCAACTCGCTCACACTCCTGTTGGCGAACGAAAGGCAATCATTAACCCCTTTTCTTACGCCAAGGCTCACGGGTACAAACGTCTAT
CGAGCGACCGACAGCGCTGGAGTCACCTTTTTCCAACGTCAAGCCATGGGACCCATCGTACAGTGGACAACACATTTTCAGAAGCGGTGGTGCACGATGA
CGAACCGATGTTCGTCGGGCCAAACTGGACAAGTCTCACGTCTCCAGCCATACTTCCGTTGACGACCGATCACTTTCCATCTCCACAAGAGCTGCGTCAA
GGCTACTCTGAAGCATTTTACACGCTGACTCTACCCACGACGGCAATACAGACGCCCACGGTCAAATGCGTGCCGCGCTATCGCAATCATGACGAATTGC
TGACCGAGATGATTTGCCAGCGACTAGCTTGCGATTTTCAGCTGGTTTCAAGCTATGAATCGCCTTCGTCAATAGTAGGTAGTGAGTCGCGCCC