Description :
From Genome Similarity Track
Location :
Scaffold_20:20348- 25010
Transcript NameFunction/comments
Phyra_76719hybrid signal transduction histidine kinase, putative
Phyra_76720Hypothetical protein

Sequence
4662 bases(100 bases per row)
GATCAAGCGGATGTACTCCTGCTCCTGAGCAATACGCTCAGTAATATCTTGGCCGATGCCTGTTATACCAAATATCTGACCGAGTTCATCGTATCTGGGC
GTGGCATTCAGCAAGATTTCAACTCTTCGCCCGGTTTTTGTGATGAGAGGAAAGTCAAAATTACCAGTTTGCTCTCCTTGGAGGGCCTTCCGGAGCAGCA
AACCAACTGACTCACGATGATCATCGGCAACAAATCGATTCACTAGATCTTTCCCCATCACTTCTTCGGATGAGAACTGGGTTATCTCTGCAACCTTTAG
GTTCCAGATGTTTACCCTGCCGTCCTGGTCGACACCAAAAATCGGAGCATTTGCTGAGTGGATGAGCCGATTAGTTTCCTTCTCTTGTGCCATTCGAATC
GTAATGTCCTGTCCGATGCCGACAACTCCTATCACGATGCCTTTCTCGTTGTACCGTGGCGTGGCATTCAGTAAGATTTCAACGCGACGGCCATTCTTTG
TGATCAGCGGAAACTCGAAGTTAGCCGTTTCTTGGCCTTCCAGTGCTTGAGACAGCACCGCCCACACTGCCTCCTGGAAATCCTCCGGAATAAAGTTTTC
GACCAGGTTTGCTCCGAGTACTTCTTCGTTCGAGTACTGCGTTGTTTCGGCAGCTTTCCGGTTCCAAATGTTCACACAACCATTCGCATCCACTCCAAAG
ATTGGCGCATTCGCAGTATCGATAAGGCGCGTGTACTCCTGTTCTTGAGCCCGTCTATCTGTAATGTCCTGGCCAATTCCAACGGCCCCACAAATGTTGC
CAAAATGATCATACTTCGGCGTCGCATTCAGCAGGATGTCCAGCCGATGCCCACTTTTCGTGATCAATGGAAAGTCGAAGTTTGCTGTTCCTTCTCCCTC
CATGGCTTTCGATAGAACTTTGCGAACAGCATCACGGTAGTCTTCCGATATGAACTTGAAGATTTTTTGGCCCATTGTGTCTTCATTTGTGTAGTCGGTG
ATTGCTGCCGCCTTCTTGTTCCAAATGATCACCTCACAGTTGCAGTCAACTCCGAAGATGGGGGCATTTGCTGTGTCGATCAGCCGGCTGTACTCCTTCT
CTTGAATAATACGGTCCGTTATATCCTGTCCGATTCCGACAACACCCACAAGCTGGCCTGTGTGATCGTAGCGCGGTGTAGCATTCAGTAAGATCTCCAC
TTTTCGTCCAGTTTTGGTCACCAACGGGAACTCAAAGTTAGCCGTCTCAATCCCCTGGAAAGCTTTCTGAAACACTGCGGCCACTTCCGACCGAAAGTCT
TCCGAGATCAACGTATCTACCAGATCCACACCCATAACTTCTTCGGGCGCGTACTCGCTAATCTGTGCTGCCTTTGTGTTGAAAATCACCACTCTGCCTT
CGGTGTCCACGCCGAAAATCGGAGCGTTTGCTGTCTCAATGAGCTTTCTATACTCCATCTCCTTGGTGTTCCTCTCCGTCACATCTTGCCCGATAGCGAC
GACGCCCATCACGGAGCCCAGCGTATCAAACCTCGGCGTCAGACACAGCACAATCTCCACCCTCGAGCCTCTCGCGGTCACAAGCGGGAGTTCAAAGTCT
GCGCCTGCAATGCCCGAAAGTGCCTGGTCGATCTTCTCCGAGACGATCTTCCGGAAGCTCCTGTCCACAACTGGCAGCAGCGGTTCCCCCACCATGTCCA
CGCTGGCGTACCCCGTCATGGACGCCGTCTTGAAGTTCCAGACTGTAATGTTTCCCTCCTTGTCCAGCTCGATGATAGGCGCGTTGGCCTGCATCATGAC
GGTCGCGTACTGCTTCTCCTGGACGGCCCACTCCGTCACGTCCTGACCCACGCCGTAGACGCCCACGCACGCGCCGTCCTCGGCCAGCAGTGGCGTCATG
TTGGTCAGCACCTCGGCATTGCGGCCCGTGGTCGTGAGCAGCGGCACGCGCAGCTCCAGCACCGGTCGCTTGTCCGCGATGCAGGCGGCCACGACAGCGG
CGACCTCGCGCTTGCGCTGCGCGCCGTACACAAAGTCGGACATGGGGCGGCCCAGCACGCGCTGCGAGCTGAAGCCCGTGATGTCCACGAGGCGCTTGTT
CCAAACCGTGACGCGTCCGGCGACATCGACGCCCACGGCGGGCGCGTTGGCGTCCAGCAGGAGCTCCGCCAGCGCCTCCGCGTGCGATCCAACGCTCTGT
GTGCGCAGCTTCGTGGGCGGTGGCTGCGTGTCCAGCGTCTCGGCCGCATTGTTGTCGAGCGCGGAGCCGCCACCCGCCGCCGCGCGCTTCCTGTGCTTGC
CCATACTCGGCTCTCCCCTTCTCAATGCGGAGAGGTTTCCGCTTATGGGCCTGGAGGTACCATCGGCGACGGATCGAAGACGGGTAGAGTCGCGGCTGGA
CTACAGTGGCATCGCTGATTTCTCAACAGTTTTAGAAACGTATAGTTGTGTATACTGTATTCCCTTCTAAATGAGAAATAGGTGGTAAAAAACTCTTGAA
AACGGTAGTACCTTGAATATGTGATATAATCAGATAGGTATGGAAACGATGAGCACCCCCGACTAAGTTCGAAACCAGCTGGTGGCCCGGCTCTACTGGA
ACAGTTGACCTTCCGAGTCACAGCTTTTGTACCGAGTGTCTCGCCGGTTGAAGACAAGCTGTTTGTTGCTTTTTGGTGCAAGATAGACGATAGACGCGAA
CGCGACTGCGACTACTGCTTGGAGAGGCTTCGCGTAGTCTTCGCTTGCACGTGACTGCGCGGCTGGGGTGGATTTTCGGCAGGTTATCAGCGGTGGCCGT
GGACAAGCCAAAGCCAGCACTATCCGCATGACGAGAGGCTCGCACCGGCGCGAATCGCACGAATCACCTGCAGATCTGCGGCATGATGCCAGCATCCCGC
GTTGGTGGCTGCTGCACGCGCGTCTGTCGCAAAATGCTTGGGCGAGCCTGGCAGCGCACTTGTCCTTCAACTCGTTGCCCGCCTTGCACGCTACCGGTTC
AGCTCGTGCTCGCGATTGTCCCCTGAGTCAATGTCCGACGGCATCCGTCCGACCAACCCGAAGCCCGTCGCGCACTGCACGGCCTTGCGGACTTGAACTC
TTTGTTACCACGGTTAGCTTTCACGTATTCCGTCCCAGCGCCGCTGGGCCAGTGGTGGTGCCTCCTCAATTGTTGAAGAGCATTGATGGTCGTACATGTA
TGGTCGTAATGTACAGTATGCACGAGAGTCCATAGCTATTATAGCCGAAAAGGCTGTTTGTTCAACCACGCTGGTTACCAGCCTGGCAGTGCTATAATGC
ACGCCGATGAGGCATCGCCAAGCTCTGTGCAGGGGCTCACCTGCGCACCCCGGCGTCGTGATCTCTGGCGACGAGCTCCAATGATCACATCACCAGTTGT
GCTATAACTGGATAAAACTCAAGCCAATCAAACTCCTCCAAAAGCGTATCCATTTCCGAGGAATCATGTCCGAGCGCGAGCATGCGCCCGCGGCGTCCGC
CAACGCGCCCGACCGCTCGCTCCTGGCCATGATAGACGAGGCGCAGCATCGACTGCAGCACCTGGAGATCTCGTGTCGCCAGATTCTGAGTCCTGCGGGT
TCTATCAGTGCTCAGCAAGACCCAAACGCCTCTCCTCCCGACCCCAAAGTGCTGCAGCTGCAGGTCGCGCAGCTCCAGACGCAGCTTCTAGCCGCTCTGG
ACCGCCGCGAGGAAGAGGATGTGGCCTTCCGACAGGCAGCACAGTACACGACGGCCAAGGGATCGGCCAACGGCGTCTTGCATGCACTCTTCGACCAGGC
CAGCTCCGGCAAAGTGGCGGTACTCACGACGTACCTGGACACGGGCTCCATCCCCACGCGCGATGGGCTGCGGCACTGGAAGCTGGATCTACGTACTATC
CGCAATGAAGCAGGCGCGACGCTGCTTCATGTGGCCGTGGGGGTCTCCACTGCGCGAGAAAAGGTCAAAGTGAAGCTCGTGCATCTGCTCATGGACCGAG
TGGACTTCGACCCGAACGTCCGGGATGTGGTAGGCGCAGCTGCTGCTAGCTGCATTGCAATAGGCTTCAATTGGTGACTTGTGTGGGGTGTTGGCGACAG
TTTGGACAAACGCCGCTGCATGTTGCGGCTATGGGAGGGTACCAAGAGGTTGATAGCCTCGCGTTTGATGGATTTTGCCTTGTGTGTTTAATTCTCTGTG
CTGGCGATGCGGTGCAGGTGGTGCAAGCGCTGCTTGAACGAGGAGCCGATACAACTGCTCAGGACAGATCCGGTCTCACGGCGCTATCGCTGGTTCGAAC
GCTGTCGAGGCCGCCGGAGGAAGTTGTTCAGACACTGGTTCAAGCGGAAAGAGCGGCGATGCGAAGTATGGCAAGCCCTTGCTATTCCTGCATTTTCGGT
ACACTTTTGCTGATTTGATGTGCTCCTGGTTTGTTGTGTGCTATGTTGTTGTGCCAGGTATTTGCTCCAGGTCGGAGTCAATTCCGCTCTCGGTAAGTAT
CCAAGTATCAGCGCTTCAACATACGAGATTATTGCAGACTACCTAACGACTATGGATTTTTTCATGATCACAGAGAGCGATTGCATCAGCTATATTCCTA
AAAGGGCTTTCCGGGTTCTGCCTGCAGCAGCACATAAGCACATTCACTCGACAGGCGACAGC