Description :
From Genome Similarity Track
Location :
Scaffold_88:20345- 21410
Sequence
1065 bases(100 bases per row)
AAGGTCTGGAATGATTCGACCTTCGACTTCACCACACGGGGCCCCAACGTTCTGCGTTAGGAAACCGGACGGCTGGAGAATTGTCTATGATTATCGAGCC
ATAAACTTGAATACTGTCCGTCGAACTCTCCCAATGCCACGGAAGGATGTGATTCTGGAGAAAATGTAAGGCTGTCACTACTTTTCGTGTTTGGACCTTT
TGAGTGGTTACTATCAGTTCCGAATGCATGAGGACGGTATTCCTTACACAGTGTTTCAAACTCCGGATGGCTTGTTCGAGTATTTAGTGGTGCCGATGGG
TCTATCGAACGCTCCCGCAACGTTTAACGCTGGGATACGTGCGGTTCTGGCGGATCTTCATGATGTTTGCCAATCATATTTTGATGATATATACGTATAC
GTCTATACGAAGAGTCTCGACGTCCACGATCATCTTCGAGCACTCGACCGAGTATTTGCCCGACTACACAAGCACAAGTTCTATGTGAAGTTGAGTAAGT
GCGTGTTTTGCGCTCCATCCATACCTTGCCTGGGCGACATCGTTGGTCGAGAAGGCGTAAAGATTAGTCCAGCAAAAGTTCGAGTGATCCGACAATGGCC
ACTTCCGAAAACAAAATCTAAGCTACAATCATTTCTCGGGACAGCCACGTACGTCCAACGTTTCTGTGATGGCTTCGCTGTGGATGCTGGACCACTTTTT
GATTTACTTAAATCTACTTCCAAGATACTACCGTGGAATGACAACCTTCGCCAACATTTTGAGTCCTTGAGAAGAATTTGCCGTACCCCAGTGCTAGGAA
TCGCGGATTTTACTCAACCATTTTACTTACGGATGGACGCATCAGATTTTGCGATGGGAGGTGTATTGTTTCAGAAGGAGTTTCAAGCTGGAGAAGAAAC
CGAGAGACCAATCGCATTTGCCGGCCGGAAGTACAAAGCAGCAGAGAAAAATTACTCGATTCGGGAAAAAGAGCTTCTTGCGATTCTATTTGGCCTTCGC
ACTTGGCGTGTTTATCTCTTAGATCATCCGTTCGTCGTCGAGACGGATCACAAGAGTCTGGAGAC