Description :
From Genome Similarity Track
Location :
scaffold_35:203434- 206739
Transcript NameFunction/comments
Plaha_PHALS_01451TRP-like family

Sequence
3305 bases(100 bases per row)
TTAAAGTGTGAGGGTGTTAGAGTGGTCGTTGACGGAGCGATCTCTGTCCACATCGAAGTACGAGAAACTATCGTCAGAGTGAGCGCTGAGAAACGACTGA
TTAGACGACAGATTGGACGACTGATTTGAGGAGCGTCGCTTTGATGAGCCATCGTCACTGCCGCCTTCATTATGCTGACCCTTTGCGTTAAAATTTAATC
GAGATGTCGTGAAATTGGATTTCGACTGGTAACAGTACGAATCTACTGAGTCACGCGAGAATGCTGATTTAGTTACACCAAAAGGCCCAAGTTCGTAGCT
CTGTCCCTCGAGTGCTTCGCTCTCTCTGTCGTCCGTACTAGTAGCGGCCCCTGAATGATGTTTAATCCAGCTATTGTGGTCACCATCAAAGCTACCCTCT
GAATCGTTCGAGAAGATCGACATCTTGGCTTGAGGACTACTACCAAAACCACCACTTTTAGCCAAGTGAGCAGCATCGATGACAGTTGAGAACGTGTTGT
CTGGTTGTTTGATGGTACTTTGCCTACTCACAGATACTGTCGAGTCTGAGAAGTTGACGTAAGATTGCATCATGGCAAATGAACTGGATGTTGAAGCACC
TGATGCACTAGGATCAAACGATTGACTCGAAGATGAAAGTTCGAAAGTCTCAGCTGTATCGTCATCGATATCCACATCATCAATAGACACATCCTGATAG
AGATTGACAATGTGTTGCCTTCGCGACGAGGAGGATTTGGCTCCTGAATTTGAGAAATTCTCAACATACGCGTCAAGTGCAGCCGAAGAAGAACGTGAGC
CAAAGCCAGATCCAGACATCGTAGCTGTTCCTCGTGAAGATTTGAGACCTCTTGACGATGATAAGTCTCTTCTTGATGACGTTAGATTTTGTGATGATGC
CAAACCTCTGGACAAGGACAGACCACGTGAAGTTGCCGAAGTTCTTGACAAGTTCAGTCCGCCAGGAGAAGTGAGCTCTTTTGTGATAATGTGGTTATTT
CTAAATGTGTGACCATTTGCTGCGCTTAACGACGTTGCGGAGAATGCAGCCTCGTCTTGCATCGAACTTGTCCCGAGGTAGGCGGCCAGCACATCGTATG
TTGGTACTTCTGGAGCAGGTGCAGCAGGAGCAGGCGTAGTATTATGAGATAGCGGTGGACAATTTTTGCCTCGAGAGCGACTGAAGATCGGAACAGGCTC
CGACGCTGGCTCTAACATAGGCACGTTCTCTAATTGCCCATTATTAGAGCTCTGAGTACTGTATCCGGACATCGTGCTGGAATGCGCTCCATACTGATGC
TGGTGGCTTTGCGATTGttgattttgatcaaattgttTGTTTCCATACCAATCCCCGCCTCTACGTAATGGTGTTGACTCCACCAATTCAAAGGAAGGAA
CAGGAGAGGAACTGTTGCCGAAATCAGTGTTAGTTCCAGTCGCATCCAAGTTGGAGTCGCGCTTACCATACTTCTTGTGACGACAAGCAATTATTGTCGC
GTGGACAATCATATACGCCTGACGTATAAACAACAACGCGAAGATGAATATGTTGATTCCAATGATGCCATAAGCCACGTTATCGCGCAGATTTTGAGGA
AAGTAGTCGTCTCTTGCAATCAAAAGCATGAGACCAATAAGAACCACTTTTAAAAATACCGACGTGATCCCCACGTAGTATAAGAACGGCAGCAAATTCG
GCTGGCGCAGAAGGAGCAAGATTAAATACAACATCATAACAGCAAGAATGCACAATAACTGCGACGTGGCATCACGGACGATACCAACAATGGCACCAGT
CCCGACTGCGAGTAAGATGCGCGGCACAAAAAAAAAACGGTTGTCGAAGTTGTACTGATCATAGTACGCACTGTATTTGCTGCTAAATGGCCGCTGATTG
TGTTCGTAAGTTCCAACATCCTTCAATTCGTCTGGATTTTTTCCAATAACAGTGACACCAAGTCCGAGGGTTAAAAGTACAATTACGACAAGAGCAACGA
TCCCCAAAGTAAAGCGGGACGTAACGCCTTTGGCTGAATCTCCTGAAGCATCGTTTGATATGAGATAGCATCCAGCCATCGCAAAACTGTATTGTGCCAG
CAACAGAGCCAACACAACAGCCCAAATCACTTTACGATACCATTTGCGTGCCATGTCACTAATGGTATTGCTCTTGAGAATGGAGCCAGCAATTAGAATA
AACAGTACATAAAGCACATGCAGTGCTGCAATCACAGCAACGAACGTCAAAAGCGTGTAGAAGAAGAGATTGTTGGCATCTACACCAATGAGAGCAGCAT
ATCTCGCCGGTCCGGTCTCTCCAGCCATAGACACAGCATCTGCCGCATGGGAAATGGAATCTGATAGCCTTCGAAGCTGACTCCGCCTTCCAGTACTGTT
GGAATCGCTGCTGCCTCCTCtgataaaattgaaattggTCCACGACAGTTCCTTGGAGAATTGAATGAGAAACGTTGGAGCGCCTTCAATTCTTAATTGG
CTGATCATACCTGCAAACTGGGCTTGCTCGACAATGTGCGTCATTTCGTAGAATCCCGAGGAGAAACTGAGCGCCGCGGCGGCAGTAGGCACTGTCGAGG
CCCAGAGCATTGAACTTGTACCGATCACGGCTGCACCAGCCAAAGATGTCGCAATGACGCCTGAAGCCGTACTGCCAGCTTTCGAGTCGAGAAAATGTCG
CGGGCCTGTGGTATTGGTTGGCCACTGCGTGTTGCTACCTAACACGCAGCCAGTGCAGTTATTAGCTGCGATGTAGCTAGCGTTGAGGTTGCCAATGTCA
ACGTCAGACGTTAGATTGAGCGCTTGGCGGATCTGATCCTCACCCCACGGAATCGCATACGTATAGAAAAAGAAGCCAAGAAGAACCAGGATGGCTAGAG
GCAATAGTAGTGCACAGAGCTGCGAGAGCGCTATGCAGCCGCAGCACTTAGCAGCGCAGCACAGTAGCCCCATAGTATTAAATTATTAATTGCTGTCTGT
ACGAGATGGATGTACTGCTCGTGGTGCTAAAGCGAAGTTCGCTTCTGTGCGTAAAAATTTGGAAGGAACTGGGTTTGACGTTGTTTGATAGGCACCACTA
TTGACTTGCCATTTGGAGGCGTTGAACGAAAGCAGGGGTAGCACACAGCTTTGGATGGGAACGTTGTACAAGACCGTGGCAACTTGTAGAGTTCAGTAGC
TCATGCATCAGTTTTGAAAGGGAAAAAGGGTATTAGACCAATCGACGAATGCAAAAGCTATTGATAGGCTCTTCTCTCCGGTCTTAGCTAACGTGTGTAA
GACGG