Description :
From Genome Similarity Track
Location :
Scaffold_498:2034- 6366
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_498-abinit-gene-0.42Protein kinase
Pytir_DAOMBR486maker-pir_contig_498-fgenesh-gene-0.0MMP37
Pytir_DAOMBR486maker-pir_contig_498-fgenesh-gene-0.5Armadillo/beta-catenin-like repeat family protein
Pytir_DAOMBR486maker-pir_contig_498-fgenesh-gene-0.1Nitroreductase family

Sequence
4332 bases(100 bases per row)
GACAGCAGCATAATAGTGTCAGTCTCCAGTTTCCTCTTTTGCACACTACCAGCCAACAAATGAACCAAGCCTCACTTACAAAATTGTTAACTTGGACGGA
AACGACGCGTTTTTTAGCGTCGTGAGTGCGTTGCTGCTCAGGTCTCTGTAAATCACATCCATCAAGGAAAGACAAAGAGAAAGAGGGCGGGTGATAGAGT
CAATAGCCACTACAGACAGCACGCACTCACCAACGCTACCAAGACAACTTACAGTGAGAGCAATGCGCTCGGGAATAAGGCTTCGTCCAATGAGTTGATG
CTGTTGTTGTTGAGATTGCTGTTAACATGCATAACGACACATAAGCAGGGTCCTCATTTGTCAGTAACGACATACATGCACACATATATCTTCATTAAAA
CATGACGCATAGCCACTCACAGTGTCTGCACATCGGACGGTACGCTCTTGACAATGACAATGCCCTTCCCATGGACGTCCAGCAACACGCGCGTGGTGTC
CTTGGCCTCCGTCACCGTCACGCTCTTCACGACCTCGCTCTTGCAGTCCGCGCCGCCTTTTGTGATCTGTGCCGCCGCAGATGAAGAAGACGAAATGGTG
ATCGTCGTGGCGTTCGGACACGTTGTCTCTGCACCACTTCCTATATCAGCGGACCCACTTGCCGCGGAAATCAGGTGTCGACGCGCCACCGTCTCTGGTT
CGCCCACATTCACGGCTTCAACGTCACGAAAGGCGCAAAGAACACAGCAGCATATCAGCAGCAATAGCAACTTTAACAGCACAGTGGACGGCGCGCGCAC
GTGGCGGATGCGGGGCGTCATGTGGGTCGATTCTCTCTCGCGCGCGTGCTGCTTCCGCCTTCTTCTTGCTTGCTTGCACTTTGGCTCTGAATCTGAAATG
GCGTCCAAAAATTTGGCTGTGTTGCGCGAAAGTGATCAACAAAAAGAGTGAAAGGATGGGCTACTATGTAATTGAAGAGGGAGCATTCCGGGCATTTTGA
ATTTAATGCTGGAATAGACAAAGTCGATATGTGACAAGCTATGCAATTTCAAAGTTTTGTGGATTGAGTTAAGGCATCCAACATACTGAGAACACAACAT
GTTGTTGGATGCTTCATCATGCACGACGCCGTGATTGTGAGGTGGACCACCTCAGCTGGGCACAAAAGCTCGCCTCGATGCTCATCATCATCATCACTCC
ATCATCAATCACACTAGGTCCATCCGATCGATCGATCGATCCTCTAATCAATGACGGCAGCGGCTGGCGAGAAGCGCGTAGCACAGGCACTCGAGCATGC
GCTGCGCGAGACGTTCCCGGCCGTGCAGTTCTCCATGGCGTACGGCTCGGGCGTGTTCGCGCAGAACGATCACGACGCGAGCACGTCGTTGCTCGACCTC
GTGTTCGCGGTGGACGACCCCGTGGCGTGGCACGAAGCCAACCTCGCACGCAATAGGCACCACTACTCGTTTCTAAAGCACTTGGGCGCACAGGGTGTCG
CAGACTTCCAGGTATGTCTTTATGCACTATGTGAGGGCTCTGTGGTTTGGTGGGCTGTGCTCGTCTAATGAATAGCTCTCGCCGTTTGTCACTCGCTTTG
CTGCTTGCTTTATCAGGAGAACTACGGTGCGGGGATCTACTACAACACGCTGGTGCCACTGCAGAGCAAAGCGCTGGGCACGCGCCTGATCAAGTATGGT
GTTGTGAGCTCCAAGACGCTCTGCGCCGACCTCTACGACTGGAAGACGCTCTATCTGAGTGGACGTATGCACAAACCAGTGCGTATTCTCATCCATGGAC
CACTGCATGTGCTGCGCATAGCGATCTGACATGATTTTGTCACTGTGTGCGTTGCTTTGGCGATAGGTCCACTTTCTGTCTTCAAACAAGCAGATCCGCA
CCGCGGGCTCGGCAAACTTGACGCACGCGCTCCACTACGCGCTGCTCTGTCTGCCCGAAAAGTTCTCCGAGATGGACTTGTTCATGGTACGCACGCGTAT
GCATTTTGGTCGATGCCATTAATCCAGCCCGCACAACCACGATGCCGAGAACCCTACTTATGTGTCGCTGTGGCTTTTATGCTTGTACTGTGCAGCGAAT
CGCGGGCATCTCGTACTTGGGTGACTTCCGCATGACGTTCGGCGAGAACCCCAAGAAAGTGCGCAACATCGTCGACGGCAACTTTGACGCGTTCCAACAG
CTCTACGCGAACAAGATCAAGGTAAGTAGCAGTCGGCCAATATCGATAGTGATAACGTGACCTCACAACTAGACCTTTAACCAACGTCAATCTCTTTTTT
TGGATGTGTGTAGAACTCGCCGTTCGTGTCGCGCTCGCTCTCGGACAGCAGTCTGCTCGTGGCGAACACGCTGGACCACCGAGTGCACCAGACGCTGCTC
GAGTCCATGCCGGCGAACGTGCTGCAGCGCATGCAGAAGAGCAAGTCGTTCGACGTGACGATGACGGACCGCAAGGGGACCAAGAAGCACGTGCAGCGCG
CCGTCGCGTCGATCGTGAACCGCTACAGCCGCACGCAGAGCATCAAGGGCATCGCGACCGCCGGCGCCGTCAAGACCGTGCAGTACGTCGCGCAGAAATT
ACAGCGCACCTACTTTAAAAAGGTCAAATAGCAAACAACCGAAAGCTCAAAGATGCAAAAAAAGGTTACTGTATATAAGATCGTGCTATTTAGTTGGTAG
TCTAGGCACTGAGGATGTTTTTGAGATTTCTGGCAAAGTTGGCGATCTCGAGGTGGAACTCCTTCTCCTCTGCATTCATCTGCTCGATCTGCGCGATGCG
GTCGCTCAGCGCGTCCACGAGCGCGTACTTGGGCTGCTTGCACGCCGCCGTGAACGCCTCGCCCAGCGACGCGAACTCGGTCAGCGCCTCGAGGCTGCTC
TCGCTCAGGTCGATGTCGTCGTTCGCGATCAGACTCGCGGCCGTCGGAATGAAGAATTCGTTCGCAAGGAATGCCTGCGCGGTCTCACTCGAGCTGCGCA
TCAGGTAGCGCACGAAGAAGAGCGCCTTGCGTTGCAGACGCAGGTCGTCCGCCGCCTTGAGGAAGCTTTCGAGGATCGTGAGTCCGTCGCAGCTCTGCGA
GAGGAACCGCGCTTCCGCTGCCGCGTGGTGGCGCACGAGGCACGAGATCGCGAGCAGCGACTTGGCACGGCACGTCGCGTCTTCGTCATTCGCGAGCGCG
CAGAGCACTTCGACGAGTCCGCACTCAACCGCGGCGTTCTGGCAGAACGGGTTGTTCTGCACGACGACACTCGCGACTTCGGCGGCGAGCGCGCGTGTGG
ATGCGCGGTCGTTCTTCTGCATGACGTCGATGAGCACGGGCAGGCCCTTCATCTTGACAAAGTTCATGGCGTTGTCAATCTGGTCCACACGCGTGAGCAG
CTCGTCTAGCAGCGCGTCCTTGTAGTCGGCGAGCTCCTCCTCTGTGGCCTCCTCGAGCTGCTTCTTCGGCTCGGCGTCCTCTTCGTCGTCGTCTTCATCG
TCCTTGGCGAACACGTCGTTCGGGTGCTCGCCCTGCAGGATGCGCAGGATCTGGCGCATGCGCTCGTTCTCGTCGATCACCCCCTCCTTGAGCACCTTCT
CGAGGAAGTCGCGGTCCTCCTTTGTGATCTCCTTGAACTCGGACGGGGCTGTGCCGTCCGAATACTTCATGCTCCACTTCATGAGCCCGAGCCACTTGTT
CGGGTCCGCCATTGCTGCTTGTGGTGTATGTGCTTCGTGTTGGTGCGCGCCTGGTGCTCTCGATTTGGTAATGATGCCTTTGCCTTTCGACTGGTTCTTG
GATGGGTATCAAAGTGGAGTGCTATGAAGATTCTCATAGTTGGTTATGCGACTCTTTGATTTGGTGGTTCCCGAATGTTCGAATTTGTTAAGCAATTTTA
TCATTGGTTGTGAATAATTCTGTGCTATGCCATACTAAAATACTCCAAAATGGCTGTTTTTGTAAGCTCAACCCATTTCGACTTAGCTCAACACGATTCA
ACTCTCGACTCTCGACTCTCGACTGTTGACTGTTGACTCAATAAACACTAAACAAGTCGTTGTTTGACTTGATAATTGTATGAATCGATCTATTCCATTT
CCTTCGTTTCCGACAACAGCCAAAACAATAGTATCCCGAATCCTAACTGTGGTGTTTGTTGACTCTCAGTGAATCGAATTGAAGACGAGCGACGAACAAA
GAATGTTGATGCGCATGAACGTCGCGCGCTCCATGGCGATGCGCACTGCCCGCCGCTCCAGCACCAGCACTGCGACCAGAAGCTTCAGCGCAGCTGTATC
TTCCTCTTCTACATCCGCTGACAATGACAGCA