Description :
From Genome Similarity Track
Location :
Scaffold_2120:2034- 3508
Sequence
1474 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGAATCTTGGCGCGAGCAAACTCGCGCCGCGCTTTATTGGTCCCT
TCAGGGTTACGAAGGTAATCGGTGATGCCTACACACTGGACATACCATCTTCCCTACGACTACACCCGACGTTCTACGTCGGGCGACTCAAGAAATACCA
CGCAGCTACAATCCCGTCGGCCCCGGAGCATCCGCCGGCGCAGCATGAACAGGACGTCCCTCCCGACGTGCGCGCCTTGCCATCGAGCCATCCGAGCCAT
CCGTCCGCTCGCGCGGACGTGCTGCCGTCTGCGGCGCCCCGAACACGCGCCTTTCCAGCTCCCGCGTCCGTTGCAGCAGTTCCGCACTCGTTTGGCGAGC
AGCCGCTGCTGCACCCTCCGCCCGACGAGCCCGCTCCTCCGCCGTCTCAGCATCAAGCTGAGCGTCCCGCGCCCAATTCACTGCCTCGTCCACGTCATCC
TGGGCGACCAGGACGCGAGCTCTATCGTCGCGAAGGTCCCCCGCCGATTGTAGACTCGGCTGGTGATATCCGCTGGATCGTGGACCGTATTGTGGAGCAC
GAAGATCCACCTCGTACGTATGCCCATACCCGTACGAGTACGCGCTCCAAGCACGCGGTTCCGACCGCGCGACGTTACCGAGTACGCTGGCTCGGGTTCG
CTCCGGACGAAGATACGTGGGAGCCTCGCGCCGCACTCCTCCGGGATGTCCCGGATGTTGTCCGCGAATACGAGAATATGATCGTGAACGAGAACGACGC
CGCAGACGGTCCTGCGGCGAACGAGAACGCGAACGCCGGCGTGCACGTCCCCGTGGCGGCGGAGGACTCCGCTGAGTATCCCCGCGGCGTCCGACGCCGC
GATTAGTAGACTGGGCCACCTCGGAGAGCGTGCGGCGATATTTGGCGATCCACGACTGTTCACTTTCGCTGAGCGGATGCTCAGTGACGCGACGCAGCCA
TTCTTCCTCGGACAAACGCTCGGAACTCTCGCACGACGTGCAGCCTTCGCGCACGTGGACGTAACAATCATGATCGGACTCCCAGGCGTTCTTGCAGACG
CGTGCTCTCAGCTCGCTGAGAGAGTGTTCACCGACGACCTCCTCGCGACTGGTGAGCCAGGCGACGAAGTTGCT