Description :
From Genome Similarity Track
Location :
Scaffold_58:203355- 216010
Transcript NameFunction/comments
Hyaar_Emoy2807015phosphatidylinositol kinase
Hyaar_Emoy2807016hypothetical protein
Hyaar_Emoy2807017hypothetical protein
Hyaar_Emoy2807018hypothetical protein
Hyaar_Emoy2807019DNA recombination protein
Hyaar_Emoy2807020polycystic kidney disease protein 1-like 3 isoform b precursor

Sequence
12655 bases(100 bases per row)
CTCGTCATCTCGAACGTGCTGCTCGAGTCTTGCACCAAACAATTGACCTGATCTGCAAAGCGGTCACAAGCTTCCGAGTGGAACCACGAAGCTTTCAACC
CAAGAACAGGTTCAGTCTCTGACTCGACATGCTTCAAAGTCCGCTCCTGCAATGGAGTAGCAGCAGTAGTAGCAGCAGCAGAGGCAGTACTCGTTGGGGG
TCCACTGTCTTGTTTGAACGGCGACATGCGGCGCATGGGCAATAGACGGAGCTGCACAATAGGGTACAATTTCGTCACGACTGTCTGCTGCAAGAGCCCC
TTGGCGTTCAGCATCGCAGATCCATGGAGTCGGATCCGACTGAAGCGACTCGTGACGCGCTTGTGGCCGTCCTCAATGGCCATCAACGTCTCCGCGGCAG
TCGCCGAGCTCCCACAGAACCAGTCAACAGCGCCCATGCTTTCTCTCTGTAGATCAGTTAGCTACGTCTGTGGACGTAGGTAGTGGGTGTATAGACGGGC
GAATGACGGAACGGAAGTGACGTGAAGCTTGAGAGCAGACGAACGAACTTTAAACCCGAGAAGCACTGGAACTAGAAGAGTGAGAGAAGAGAGGGAGCGA
GACACCGGTAGAGAGAGAGATGATGACGTGGGGGTCTCTCTTCTAGCGGCGCTGGACGGCGGGAGCGGGAGATGAGAGAGAGAGAGTGCGTCTGGAGTAG
GTGCTTGTCGGTCGTGCTTCAAATTGAAGAATGCCGTCGCTGGCCAAAGGAGCCAGTGTATCAGTTATAAAGAGGACCTGCGAGAGCTGGTACGTCGTTG
TGCTGACAGTTTCGTTTGCCGAGGTTTTTTCCAAGTGGAGAAAGGGCGGGTAGATAACGAGCAATATGGGAAGAACGAGCGAAAAGGGAGAAAGAAAGGG
CATGTGGAGCATTATCATCCACCAGAGAGAGAGAGAAAGGGAAGAACGACCTGTATAATGGAAGATGGTGTTATGGTTCTTAATTGATCTGATGAGCAAA
GGCGACGGCGAGCTGCATTTGCTCTCGAATGTTTGTAGTTGTCGAGACGGCGAGTGCGACACTTTGTGTTACTTTTTCGTCAGGAGAAGCACGGTTTTGC
GTGGCCAAGTGCGGGTGCGAAAACATCTTGGGACGGATATTTGCGTAGTTTTTTTCGATCCTGTAGAAAAGTCGCGTTGGTGTCGCTCGCTTGGGGCTTG
TGGCACCGACCACAAAACCAAGCGAGCGTTTCGTTGGTTTGTCCCACCACGTGTAAAATCTGCAGTTGGCACACAGTGAGAAATCGTTGCCATTGAGCGC
GGCGACAGCTGGTCTTGTCCCACTGACGTTTTTACAAGCACGCGACGAGACAAATTTGTCTCGTAGAGTAACGTTTCAGTCGCTGCAAAAAGTAACTGCA
GGGCTAGTTAAGTGATTTTACGAGACTCAAACGATACCTCGACGACAACACTCTAGTCAAGAACTACAACAAACGCCATGAGTTTGTTGTAGTTCTGGAC
TAGACTACGTCCCTATCACCTATAGCGACACTCCATCGTGCTGCCTTCTTTGTACTTGTAACGGGATAGCACACGATGAAGAAAGTGCACTGGCTCTGTA
GTGCCTTGCTTGGACCGCCTCATGTTCGAGAAAGTCGCAGAGCCGTATACTAATGCTTATCATTACCACACTCTTAACCTTATTCGACATTCAAAGCGGA
TGGTTGCTCTCCTCCTCCCTCAAACAGGACGCCGCGATGAGAACGTCGTCCAACTGACGTCAAATTTTGCCCCTTCCCGTCCATGTCGAACCTTACCTTT
GAATAGACACGAAACGCATGTACCGGTATCGTCATGAGCATGGTCGCCGTCCGGCAGTATCCCCTCTCTCATACTCACGCCAGCACATTCACAGTCACAG
ACAGACCTGACGCAGTTTGACGATATTCATGTGGGACGCGACAATGTCGTCATCGCACAAGGCCTTGCTGTTTCACTTGATGATACTGCTGTACCTGTGT
CTGGTTTGACGAACAACTAGCAACAGCATTAACGTCATCTAGAGCAGCGACTCCAAAAAAGATCGACTTCGACTCGGCAGACCGCGCAACGTGCTGCTCG
GCTGTGGGTGGGCGGCTGCGTCTGTAGCGCAGCCACCTTCAACCAGGCAAGCGAGCGCGATCTTACTGGTCGTCCAAGGGGCGTCTTTCGATTCTTTGGC
TCAGTCGCAGCTGATCCTGTCCAGATCGCGACGGGAAAAAAAGTGGCGTCGGTCGAAGAGAGCTATTCAGCAGACGCTTTCTGATTGGGCGAAAGATAGC
GGAGCCGAGTCTCGTGGTCGCACATCATTCTGATTAGTAACGTTCTTTTTACGCTCGTATGGGCGACGTCCCGAGGGGGGCCGCACGTCATCGTGATTGG
TGCTTACTGTACTCGCCTCCTGAAGCTCGTCTTACGTATCAGTTGCTCTCGACCCACCCGGATCGCAGTCTCCACTACATCTATTGGTCAAATAGCAAAT
CCCATCACCTTTTGATTCGTACAGCGCGCTTTGTCGACTATCTGCGAATCAACGGAGCCTTCCTGCCCGGGTTGGATGGCTCACTTATCAAGCCCGGGCG
GCCCGTATTCCCGGCAATACGGATGCAGTGGTCATCCCTCTTCCTCCTATTCATCGTCCTCGTGTCCTCCTCCCATCTTCCATTCAGTGGTTTGCCTTGG
TCAAAGCAAGCGCCGGGTGTTGCATATCTATCTCCATTGCGTCTCTCTGTACCTAGCGCCCCCCCTTGCTCTCCTCGCCATGTCTTTTGATGTACCTCCT
CCATCCCTCATGCCCTACATACTGCCCATGTCGTGCGATACTGAAGCACACGAAACCATTCAATGGGCACTTCTCAAGGAGAAACACTACACGGCCGTCC
GCAATCCGCTCTACTTGTCTCAGGTTCAGCACCACGGCATGACCGCCACCTGGCGTCTACGTGTCTGTCGCTGGATGTTCGAGACCGCGAGGGAGTTTGA
CCTGCAAATGGACACGGTCTTCACTGCTCTGCACTTCCTCGACCAGTACCTCAGCGTCCACTCGGTGGATCGCGGCACGCTGCAGCTCCTGAGCATGATC
TGCATGTGGACAGCCAGTAAAATGCGTGAGGGCAGACCCATTCTCCTCGAAGAGATGGCGCTCATGTGCGAGCGCAAGTTCACTCGTGCTCAAATGGTGG
ATGCCGAGGCGCAGCTCGTGCGGCTTGTGAAGTTCCGCTTCAATCCTCCAAACGTCTTTACAATGGCGAGAGACTTTGTCAATGAGCTCCCATTCGGGAA
AGACAAGGACCGACGGGCCAACTGCGTCGCCTCCGTGTTCAACGTCCTCGAGCGAGTAGCAGAGGACATGTCGCTGCTTGACTGTTCCGTCTCAAGTCTC
GCCAAAGCTGCAGTACAACTCGTGGCCAAGTCCGAGTACAACCTCTCGGTCGCGCAACTGCTCAAGGCTCTCAAGCTCGTGAAAGTCGAGGAAGACGCTT
ACCGCACAGCCTTCAAAATTGTGCGGGGCGCCTACTTTGGCACACCCATTGTCTCAACAAAGACCCAAACGCCACCACGGATTGTTACCACTACCGAGGT
CTCGGAACCCATCAAGTCGCTCACTCAGAGCCCTACGGCGATCGAACAAGTGCCGCAATTCCACGATGACGGAGCAGCGTCGTCATTTGCTGCCGTCACT
GGCCTGGACGATGCGGACCTCATTTGCACGGAGACGCTGTCTCCGTCGCCAGCTCAAGTACCTCTTGCGCCTGTGCGATCGACGTCATCAACTTCGTCGA
CCATTGGCGTCCCTCGGACTGCGTCATCACCTGCGCGGTCCGTGTCCGACGCTGAGCGACCTAACAAACGTCAGCGCAAGCTGAGCATGTAGACGCACGA
TAGGAACCAACACCAGTGTAGAAAGCTGAACACCAAGTAAACTAAGTTATACTCACAACCACTTCTTCCAGCAGCCTCGCCTCAGTCACTGATTTCAATG
CACGTCACACCTCCGTCGCTGCTTTCAGCATCGTCATTGCGTGCATGACCAGTTCTGCCATCAAGACGGCGCGGGTCTACTTCTTCAACTTGCTCCTGCT
GCGTAAAGAAAAGCGTTCGAATATCTCGAGTTGACAGCCTTGTCTCGCGAAGCCTGTTGTTCTTGTTGGTACTGGAGACGATATCGCTATCCCCCAAGAA
AGTAGCCGTCAGCTGGCGCTTCTTGGTTTGCAAAGCCATGACACGCTCCTCAATAGAGCTTTTGACAATAAAGCGGACAACGCGCACCTGCTTTGTCTGG
CCGAAACGGTGAGCGCGATCGATTGCTTGGTGTTCAAGGCTCGGGTTCCAGCTAGGTTCTATGATGAAAACATGCGCTGCAGCTGTGAGATTCAATCCGA
GGCCACCAGTACGCAATGATAGCAGAAGCACGTCAAGCAGTGGACCAACAACTGATCCCCTGTCGAAACTAACTTCCTTTTGCTGGAAATTGTGCACCAC
TTGCTCTCTCTCCTTGGCGGACATCCTACCGTCTAATTTAGCAAACGCGATAGCCTCATTGCCTGTTTCTCGCGCATCGTTCAAGGATGAAACTCTTGCC
TCGCACTGCGCATTGTGAACTTCCAGGTGTGCTCCTATCATATCCAGAAAACTTGTCCACTGCGAAATCACCAAAACTCGCTCTCGACAAGCTCGTACGC
TCTTCAGCTCCTTCATCAGTGCTGTCAGTTTTGTAGACTCCAATGAACCGTGTCCGAAATCACTATCCGCACCCGAGCGCTGCTTCCGGAATCGCTTCAG
CAATTCAGCCTCAGCATCTGAGAATGAAGACATGCCATCGAGTCCTTCGTTCCCAGCTAGCTTTTCTACTCGCATTCGAACGTCCGCTAATGGGTCTGCG
GTCACCAGAGCACAAGAATTGCACACTTGCCTTAGCCGTAGGATAAGTTCGAACACGTGCATAAACAGAGGTCGGTCCGTGTCGATCTCGGTTAGGCTTG
TACAAGAAGCTTGACGAGCTTTTCGTTTTGCCTCCTTCGACTGCAAATACCGCAACACTTGCCGTTTTGTGGAGCGATACAACAGTAAATACAATACACG
CTCAATATCTGAGGCAAAGTCGAGCTCGATAGTCGTTTCGGACTTTTCTGGTAGCTCCAAGATAGGAGCCCCTGAACGCGTTTCCACCGTGGACTTTAGT
CGACGCAAAACGATACGGGGTACAAGCAATCCAAGTTCCCGTTCAGATAAAGCATGGGCCCGATCACCAAGTCCAACAAATTGCAGCAGCGCTGCTAGAT
CCGCTGTTCGATTTTGAATTGGTGTTCCGGTCACACACCAACGGCGTCTACTGCTGAGTGTAAACGCAGCTCGCGCTCGTCCACATCCAGCATTTGCAAT
GAGATGGCTTTCATCCAGAATGACTCGAAACCATTGCACTTGGTGCAGCCTCGATGTCGCTACAGATTTCTGACGTCGAGGAACAAGGCGTGGCGCTTGG
TGCCATCCATCTTCTGCACCCCAGCCATTGTGTCCGTCACCATCATTGCCACTGCCTTTACTTCGTACTTTGCACTCCGAAAGCCGAAGGGTGTCGTACG
TTGAGAGGACAATGTCTGCTCCCATGAACTGCGTGGATGAGTGGAAGCTCTTGCGCGCAGCACCTTGGTAAATCACTACACTCAAATTCGTTTTTGCTCG
AATCTCTTGTTCCCACTGCGTTAGAATAGACAGCGGCGTTATGATAAGCGTCGGAGGAATAATCCGGAGGACATCACTACCAGTCTCATTACTTGCTTGA
GCGTCAGCCGCTCGAGCCTGACGCAACGATTCACATATTAGAGCAAGGCAGCATACCGTTTTACCAAGGCCCATTTCATCTGCCAATATCCCACCGCGCA
CCTTCGCTATAAACGCGTCGACAGCCGTTGTGCCACCGCACCGTTGACGATCAATAGTGATGGTATCACCAGGTTCCCGCTCTCTTTCCAGCATCCATCG
TAGTGCCTCCTTTTGATATGACTTCAGTTCAATCACAAGTTCTGGCACAACGTATGGAAACACGCCCGGCTTGGCCGCTAACGATTTTCGGCGTTTATGA
CGCCGACGCCGGTCGCTAGCAAATCGGTACTCCATCTGAAGCGGCAGCTTCGTGTGCAACAGCGCACCTCGGATTGCACGTTTTCGTGATGACGCCGACC
CACGAAGTGCTGGAGCGGTGGTCGGGAAATGCTGCGCTGCTTCACTTGTCGATGAACGAACAACAGATGCATGCAAGGCTTCCCTTGCTGGCAGAGCTGT
TGACGTAGCAGGCGTTGTTATATTCGCAGGCGACGTCAAGCTTCGATTAGCCGACAAAGCTATCAATGTCGTACAAGACGCTTTTCTTGTCGCTTGCGCA
GTAGTAGGTGAATACACTGCTTTTTTCACCATGGACTCTGCCGATGAAGCGCAAGTTGACTGACTTGTCAGCACAGGTTCATTTTGCTGTACTGCACGAA
TGCACTTCGTTGAAGTGGGAATATGGACTGAGCTTGACATCCCATCAGTGTCTTGCTGCCTAGTACGATCATAGACATCTTCTGGTTCTGGTTCTGTAAT
ATCCTGAACAGCATCAATGGTATAAAGTAGACTTTCCACTGCACGTTGCGATCGATGATGTGTCTCCTCATCTTGTTCCTCATGCGTAAATGGCTGGTTC
TCGCTATCGTACTCACTTCCCGTTCCAAACTCAAAGTCAGCTTCTGAATGCCTGTCTGGCTCCTTTGTATATACATCACTACCGTCAGAAGAATTGACTG
AATTGACTTTACTCTCAACATCGAGCGGCGTGTCTGCATTCCCGCCTCGGTCATCAATCACAGCGTTGGCATCAACTTGCTTGTTCGTTTCTTCTACATC
ATCGTGCTTCATATCTTCATCTTCTTTATAACTGCGGAAACCCAGCCGTCGAGAGGCATTTGTACCTTCTGCTTTACCATGCTGCTTCGCTGCACGCACT
CGAGCATTTTGTTCATCAGCGTCTATTTTCACATTCCCAATATGTTGCACTTTTTGAACCTCTTCTCTGCGTATAAGTCCCTGCACCGCCACATCCTTTC
CCTCTTTCTCATAATCTTCCAATATCTCGGTCACTTGCGTACCTTCTACCTCTCCTTCATCCATTATACAAAAACTCTCTTCATCCTCACTCAAGTGCAA
CGAATGCATCGAAACATCCAGCTCTTTGTCCCTAAAGTTTGACTCAAGTGAAATCCGACGTGTTTGCCGTGTCTTTCCAGTCCACTGTCCCGACGTCCAG
GGCGACGTAGCTGCTGCTGCTGAAAGTGGAGAGATGGTCCTTGCACGTTCAATAGAAGATCTCAGACTTCCAACAATTGGCGACACGTCAGCCATTCGCA
GTTGTAATCGCTGCGAGGCGCTAACTCGCCGTCCTGACGTCGAGTGGGACCTAAACTCCTCCGGGCCGAAACCTGGGAACTCGCTTCGGTCATCTAAAGG
AGGCGGAGTGTTAAAGACATACGACTCTTCGGATAGAAGAGACGCGTTAGGTATCGAAAGCGATGGCGATAATGCTGGGACAGGCGCAGCCCACACACTG
GGACTCAGAGAAACGTGGGCGATGCCTGCTGTCATCAAAACGTCTTGCAGTAGCTGCTCGTCAGCCGGATTGACAGATGGAGAGCACTGGAGTGCGTACG
TGCCAAAGCGATGGGCGATCACTTGCCTCGTGTAGTCGCGCCAGTCGCGCTCGTACTCGCACCGCCATCGCGGCATTCGCGTTTGAATTTGAAAAAAACT
TTTTGAAACTTTCCGCCAATGAGACAAGCGCCGCGACGTTTGATCGGAGTCCAGAGGCAGGGAGGTTGAAGTAACTTTCAGTCGACTTCGTATCGACACT
TCAGTCTTGCGATGGATGGTACTTCAGCTACAAAAGTACGGTAGTACGGTCCAACCACGGCAGAAATGATCGACAAGCAGGAGCATATTATACTAACAGT
CCGATTTCTATTTTATGGCCATCCCTCGACATAGCGCCAATTAGCAGCCCCTCTAAAACTTGTTCCGGCGGTTTTCAACAAAACTGGCATTGGGGTGCGG
GCGATGTTACTACTAATACGGGGTATACACACTATGGAAACAAAAGTGCGTCTTGCATCTGCGTCGCATGGGGAATGAGGCAACGGGGAGTCGACGGACG
GACTGCTGACGGGGGAGGACATGAGACAACGAGACTATCGCCGCCGCACGGAAAACCGCTGGAACAAACCGCCACCTGGTTCAGCCGATTCGGGGACTTC
GTTCGCCCCCAACGAAGATGTCGTCTTCTTGCTGAACGCAAAGAGGAAGCCGCGGTGCGAGCTCGAGTTTTGTGCTCTCCTCTCTTCTGCAGCTTGAAGC
AAAGACTGGCAATCGTGGAAAAGCAGATTCTCCGGGCTGAGCACGTTGTACACGGTCTCGTCATCTTGAGGATCAGGCTGCTGGGTTGAGGCGTTCGGAC
ACGGTTCAGGGTGCGGACCAAACAAGCTCGTGGCAGCGATGCTAGCGTAGTAACCAGCTTTCGACTGCGCCATCGTTGCCAGGTGGAGACCATAGCTGGC
CAACGATGAAGTCGACGATACAGTTAAATAGTTGAGTGATGTCAGCGAGTTGCGGTGCTTGAGCAAATCGTCATCTTTTGCCTTACTCAGTAGCAGACAA
GAGTGGCCGACCTGGCTAGTCCCATCGTACTCATCGTCGCCATAAGGCCCCACGACATTCGTGACTGATGGACAAACAGCCATGGAATCTAGCGAGCCAA
TAACAGACACTGGCTCATCATCGTCCGCCTTGTCCCGGAAGCGTAAAGACTGGCGCAGTTGGTCCACCTGGTCATTAAGCAGCGAGTCCAGCGCCGCAGA
ACTACCACAATCATTCGTAAATGAGAGGTCGGCGGTCGTGAGATCCATGTCGCTAAAGTACCGACTGCTATCGTTACTCTGATGGTAGGGCGGAAGCGAT
GACGTCTTGCGGAACAAGTCGTCTTCAGTGCCCGAGTCCGACATACACTCCTCATCCATGTCACGCCGACGCTGGTGTCGGCACTTGACAACATCATAGT
TGAACCTGGAGTCACCGCTGCCCGCCAACCCATCCGCAGTAGGGGAGTGAGCTTCAGATTGTTCGCCAAAGATCGAGGTCAGATCCGAGCTATAGTCGTG
CAAAGTAGGCTCCGACGACTCGCCAAGTAACTTCTCCGTGTACTCAGTCAGCTTGTCAAGCTGCGATCGTAGCATTGTTGAGTGGTTGCTCTGCTGCTGC
AGTCGTATCTCTAGCATGGCGTTCTTCACTTCCATCCGCTCACTCTTTTGGCACACAGCCTCATACTTGATCTGCAGTTCCGTGTACGCCTTCTCCACAT
CACAATACTTCTTGTCAAGGGAAGGTACCACTGATGCAATCGACTCTGAAACCGAGACCTCTTCACTCCTGCTACCACAGCGACGCACCAGACCAGCTGA
GGTGAGTGTTTCAATCCATTGTGCATTTGTTGCCACCATTGTCTCTAGAACCGACTTCATCTCAAACGTCTCTCTCTCCAGGAACTCTAAATGATTATCA
AACACCGTCGGGGGTGGACTATCGCAGTAGCCGACCTGATTAGTCATTGGACACGTTATCGACGCCGCACGCGTATGGCGCGACGGCGGCGACGAAGCTG
CAGGGCACTGGAACGATGCAAACACGGGCGGGCCTTCAGACTGCTGCGGCGGCGTCGAAAGACCCGGGTTCGTGCTTATCCCCATCAATGGCCGGACGTC
ACCCGCTGACTGGAACGGTTTCCGGCTGATCATTCTCTTCGACGGACGTCGCGACGTGCCATTGACTGTCTGCAGGGGCATTGGTCCAGATGAAGCCGCC
AGGTTCTTGCAGCATCCTAAAGGTTCTTCCATGGACTCGGGGGACAAATCCGTGATCGTGAACCGGCCTCTCACTTGGGTCTTGCCTTTGCGAACGGACG
AGCTGGACGCCGACAGGTCTTCGCTATTATTATAAATCGGGCTAGGAGCCTCGTCAGTATCGTCTCGTGAGGGCTCCGAGATGCCCGAAATGGTGCTGAG
CCCTGTACTTGGCTTGTGCATATCCAGCTCTTCATCCGATACGTCCGTCACGACGAACTTCCGCGGCATACGGAGCTTCCGACCGGTTATTTTGGGCAAT
GAACAGCGACGGTGCACGTCAAGACGCGCCTCTGAGGCTGAACGTGCAAATGGCGTCTCCTCTATTGGGTGCGAGTTGGACGCTACGACGGAACTAGTGG
TCGTCATGGAGTACAAATGCACTAACGTCGGTGGCGTATGCACCGGTACAAGAGCTTGTCTACTGATTAACTAATCGCGAGAAAGGCCGATCGGTGTGGA
CGATAAAGACGGACGGGACGCTGGCTGCGCGGCAACGTCCGAAAGTCTCGAGGGTCTGATACTACAAAAGCCGTTTTGGCCGACGAAAAACAACAAAACC
CGGCCGGCTGCAGATGGCTACACATGGGTTTGGCGACCCGAGTTCAGGCCCGAAGACGTTTTCTACACCTCCGAGCGCCCAGTCGTGGGACAGCTCGTTT
CTTTTTGGACCAATCCCGTGCTCGTAATGAGATAAACCGTTCAGTTGTGGGAAGAGGCAAAAAAATCCGGTCCCGAAGGTTTTGAAAACAGTGGTAATAA
AACGCAGTGTATACGTAATTACCACTGCGAAAAACAAATTACGGATATTATTTTATCTAGCGTAGGGAGGTCTGTGAGAATTAGTGCCCAGTACAAGTCC
CAACCAGCGACTTACTGCGACTTGTGCAAAGCGTCTGGGATGATCTCTCTCGACGGACATTTTCTGCTGCATCTTGCGGCTGGTGAGAAACATAACGTCG
TGCCCTACAGCTGCGAGCCACTAGGTCCACAGTTTCGAGGTGTCGTACTATCATGCTGCAGGGCGAGGCTTTACAGCCGATAAAAATTATGGACTATTGC
GGACTGCACTGATCTCTTTCCGTGTTGCCTCATGGTCGCTACCTGTGGGTTCAGCGGCAACTTTTCTGATCAGCTCGGAATTTTTAAGTTTGTCAAGGTA
GTTGTCTTCAACGATTAGCCTAGAACCGTACTTAATTGTTGCCGTTGAGCTCTCGGTAGGTACGGTTGATGTTTTGGTTGGTTCCCGGAACGACTGGCTG
CCACGGCGTGTGAACTAGAGTCCAAGTCAGCGACTCTACTGATCATTACGAAACGCGCTCGCAGGAGCAAACGTAACTGAAGAGCGTATCCGCATGTATA
TATTCTGTCTACCTCTGTCTCAACTGGATTCTGGCGAGATCTCTCTTTCACAGTAGGGATCCCAGGGTCAAGCAATTCGCCCCGAAGTGGAGTGCGTGCG
TCTTTTGCCGTCACAGATGGTTGAGTGCGTGCGCAAGCTCTGCGCAATCGTGAGGGAAAAGCGAAGCAAACAGTTGAATATTAAAGTCTCGGTTGTTGAG
CAGATGGACCGCCTGGCGACCACGGTCGCCTCGCTGGAAAACTTGCTCCAACCGGTCGACGGCTCCATATTCCCATTCTTTTTTGCTAGTCACATCGACG
ATAATGCTGGAGACCAACCATGGAGCAGACATTCTTTCAATCATCAGACTCATTGCAAGCTTATAAAAGACTAAAAATAAAGTAACGTTGATAGCTCGGT
CAACTTAATATGTTCATGTTGTAGAGTCGATAAATAACGTAAACGTAGCAGCAACGATAATGGATGCAAAGCGATGGTAGATCCTAGTCATGTCGAGCCG
AGATTTCTAGCGCTTCGGGCACAATACGAAGTAGCATGGTTGTTGTGCCAACCTCAGTGCTGAAAGCTTTACACAAAAATGGTTGCGCTTCTTTCATGAC
CTTAAATAGGTTCCGGGACCGATGTAAGTCCATTTGTCTAAATGCCCATGCGGAAGCGTGTGCATTTCCTTCTCCATATTAATTCGAAACGCAAGTGCCC
ACGGACGAGGTCAGGCTGGCCCCTCCGGAGAGCATTCGACGCAAATGATCGCAACACACTTCATTGCAATATATATCATGAGGCGTATATCAATCTGTAA
CACCCATTTGCGCTGGCACCTTGCCCTGCACCGAAGAGATCCCTGAGGACACTAATATACTACGAGAGCTTAGTGACTATCGCAGATCCTGTAACAAGTT
GCAGTCTCATCTGTTGAAAGGATGACAGAACACCTCTGGATGGATTGGGGGATACTCATTTCGAACAAACGTTTGAACCTTCGAGCAATGTGGCGACGCC
TATCTCGTCGGGAAGTATGGTTGCAAATTGAATATGGTAGAGGAACTCTACCGTGACGTCTAGAAAGCATCGCCAACGATAAAAGATATCGATGTCTTCG
AAGCAAGGCCCTGCTTTTTAGAGGTCACTAGCCTTACTGCATAGACACGAATTTTAGCCTGCGCTGGTAAAGGATGACTTATAGCGTTACCAGCACAAGC
CCGGTAAGCTTTACAGACAGAACCCGCTGACATCAGAGCATTCAATCCCACCGTGGTGCTTCAGAACTTTCAGGTTATGGGCACCTTACACTCCAGCACA
TTCGCACAAAGAAGCATCGAAATTCAGATTTGCCTACACTCGCATAGTCACAGTT