Description :
From Genome Similarity Track
Location :
scaffold_1476:2033- 3660
Transcript NameFunction/comments
g11454.t1 hypothetical protein PHYSODRAFT_262200

Sequence
1627 bases(100 bases per row)
CGCTGAGGCGGCTCAGACGGTCTCAAACCTCTCGTCCAGCCTCGATTCGAGGCTGAACTTGTATGTCGAGCGTCTCTGCGAGCTCGAGGAGGCCTTCCAG
GCCTCCCAGGTGAGTTATCAACCCTAGGTGACTCGTGCTGCACGTACGGCTTCAACTGCCCGACGTAGAACGTCGGATGGAGCCTCATGCTCGACGGTAC
GTCCAGCAGGTACGCGTTGCCGTGCCGTTCAAGTATTGTGAACGGCCCAATGAATCTTGGAGCAAGCAAGCTCGCTCTAAAGTCCGACACTGCATGTTTA
GGCAGGTTTTGAGTAGCTAACAAAACCAATGAACCCTTTTTGAATTCATTCATGTTGCCCCTGCCCACATTATCAGCATTCAGCTTCTGTTGATCGACAG
AAGCTGCGATAGCGTCTTGCATAAACCGTATCACGGCTTGTCTTCGCTGGACAAAGTCTAGCGCGTTCGAGCTGAATCCTTTCAGCTCGTCGTCTTCGTC
CGCAGCAGGCCCTGCTTGCGCGCTATCACTCCCTATGTCTGTGCCGGGCACAGACATCGCGCGTCCGTTCCTACTCGAACGAGACGCTGCACGCGTCACC
CAGTACACGGTTGACGCGTTCGGTCTGTCCGTCCGTCTGCGGATGTTCCGCAGTCGACATTGACAACTGTGAACCAAGAAGTGTAAACACTTCTTGCCAG
AACCGCGCTGTGAAGCGTGGATCACGGTCCGACACAATGTCGAGCGGCATGCCATGGTGCTTGAACACCATGTCAACAAACAGTCGCGCAGTCTGTGCGG
CTGTAACAGTAGTCGGGACGGCAGCAAGATGGACCATCTTGCTGAATCGGTCCCCAAAGACAACGATGCCCGTCCTCCGCTTGCTGTCAGGCGGAAGACC
GAAGACAAAGTCCAAGGACATGGACTGCCAACACTCCGACGGAGTCGGAAGTGACTGAAGGAGCCTGCGAGAACGGCGCAGGCTTCACGCGTTGACAAAC
CTCGCAAGCACGGACGTACTTGCGCACCCACTTGTACTGGTGGTGCCAGTAGAAGTCACGCGTGAGAAGAGTGTATGTCTTCTCACGACCCGGATGCCCT
GCCGTAGGGGCATCGTGATACTCGAACATGATCCTCAATCGCAGATCATCATCATTCGGAACGACAATGCGGACCGCATTGTCGTCTACTGCACTGTACA
TCAGTAGCCCTTCGTGTACACGAGACCGAAGATAAGGGGTTAGCTTCCGACGCGCCACGTCGGAAGGTGCTGTGAGGTACGCCAGCAGCCCCTTCGCGTC
TGCATCTCTTGCATACGCGCCCTTCACGTCGTCAATCAACGTTGACGACGGCACACTTGTCCTCACGACGCCAACAGCATTGACGTCGACCGTCTCCGCA
TAGTCAGGTCGACGCGATAACGCGTCGGCCACTACGTTGCGTCTTCCGGGTTTGTACTCGACCCGGAAGTTGTACTCCGCGAAGCAGAACAACCATCTCC
CCATACGTTGCGAGATGTGCGGCGACTTAATAGCCGTCCGCAGTGATGCGTGGTCTGTATAGACCACGAACGGTCTACTTTTAAGTAGATACACTCGGAA
CTTTGCAAGTGCATACTTCATGGCAAG