Description :
From Genome Similarity Track
Location :
Scaffold_9:20322- 21406
Sequence
1084 bases(100 bases per row)
GCTGCGCATCGAGGGCGACAGCACGCTGGTCATCCAGCAAGTGCGGGGGTGGCTGTCCTTCTTCGCGGAACACAACTTACGCGTCGAATACAAACCGGGC
AAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGG
CGTATCGGGACGATGAGGCTGTCGCGTCTATCGTCAAGTTCCTTAAGACCGGAACGAGCGCGAAGTTCGACTTGCTCTCGTCGCGACAGCGCTCACGGCT
CCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTAAAGTTCGAC
ATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCGCAGTCCTTCTGGTGGACCCACATATACA
AGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCGGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGA
TTGTTGAGAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACGCGGCAACACCGGAATTTTGATGTTCGTGTGTCGGCTGATCAAGATG
GTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTGTTCGGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATT
GTCTCGGACCGAGACCCGCGGTTCACTGCCGCGTTTTGGAAAACGCTGTTCCCTTTAGTGGGAACTCGTCTGCAGATGTCTACTGCGGACCATCCGCAGA
CCGACGGCCAAACAGAGCGCGTCAACCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGTAGCTCCACGTACGTGATCAACGCAGCTCCCAGTTGT
TGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCC