Description :
From Genome Similarity Track
Location :
scaffold_29:203211- 204851
Transcript NameFunction/comments
Plaha_PHALS_05126atp-binding cassette superfamily

Sequence
1640 bases(100 bases per row)
AGTACGCCGATGACGAGAATCTGAAGTACAACCGAATAAGCAGCGAGAATGATCATATTCTTGACAACGTCAACTTGATCCATGCCGTATCGTTTGAGCA
AATCCCACGCTTCCTCCGTGTTGACAGCAGAAAAGTGTTCATACATAAACGACTCGAACGAGTATGTATGAAAGGCAATGTAGTAACCCCATTTCCAATA
CGCAGGCATGTCGTCAAATGGAACCATAAATCCTTCACACAGCATAAACATCCCAAAGAGACCAGCCCCCAATGCAATCCCCATAATATAATGAGGCACA
GCAGCACCAAGTAAGTGCATCAATGACTCGGCAGCAATTAGCGATAGAGTCAGATTTAGTAGAAACGTTGGAAGTGAATATACACGAGCAAGGAAGACGA
CAATTGTCGATGCCAAGACTGAGATAAGCAAGATACCAGGTAATGACGCGAGGAGATTCGACATAGTGTACCCGGTTAAGGACAAAGCATACGATCGCAT
CTCTCGCTCCATAACAGCACGATGTTCCAGTAATGCAGGAAGGGCAGCAACCGACATGAAAACGAGAAAAGCTTGAACGTAAAATAGCAGCGAAACCATC
GACATGTTGGTAATTTCTCGATTTGAACTCAAGTACATTGTACCCACCATAAGTGACAGAAGAACGTACATCATGACACGAAGCCAGAAAACACCTGGAT
GTCGCCAATTATTCGTTAAATTTCGTTTAACAAGAACGATTGCTTGATCCAAGGGCCATGGTCGCATAGCTTTTAATAATTCTGGATTCATCAATTGATC
ACGACGTGAACGATCACGAACCACATCAGCTCGAAGACGCTGTGGTTCAGCACTTTCTTTAAGAGCTCGAATAAATGGTTCAAGTTTTAATCCATCGTGA
AAATTTGTGTTGACCAAATGGACAAAATATTCGGCTGGATTCGTATACATGGGACATACGTAACCCATAGAGAAAAAGTGTGCGATTGCTGCATTTGTTG
GACCACTGTATACAAGTTCGCCACTACTGAGGATAATGAGATTTGTTAACATGCCGTATATAGAGGAAGAGGGTTGATGGATTGTACATACGACATTCTT
ACCACCTTCTTGACACAAACGTTCGATATATTGCATGACACCACGGGCTGAGGACGAATCGAGTCCGGAAGTTGGTTCGTCCAGTAGCAAGAGTGCAGGA
TCAGAGAGCAACTCTAATGCAATTCCTAGACGTTTGCGCTGACCtgatgaaattcctttatgaAAAATATCACCCACACGAGCGTTTGAACACGATCGTA
ATCCCATAGCATCAATGACATCCTGGACACGAGCTTCCCGCTGAACGGGAGGCATGTGACCCGGTAAACTTAATCCTGCACCAATTTGTAGTGTTTCAAG
CACCGTAAAGGCGCCTAAAAATGCCATTTCTTCCGAAACGTAGTTCATAATCGAGTGAAAAGTTCGAAGGTCTCGTGGCTGGCCATTTACCTCCACGAGT
CCTTCGAGATGAACGCCTGAACCACCAGATGGCACTCGGTCAGCAAGCATATCAAGTAGTGTTGTCTTTCCGGCACCCGATGGGCCTAAAATCGCTGTCA
ACTCTCCTGGTCCGGAACGTCCCCAAACACTGTTGAGAAT