Description :
From Genome Similarity Track
Location :
scaffold_1:20321- 22332
Sequence
2011 bases(100 bases per row)
GCTCGAGTTCTGCACACCTTCcgcgcaagtgcttcaaAGGATACTTTCTACCACGTGATAGACGCGGCCCATATGACAACCTCgtatgcggatggtgagc
AATTGACATACAAACATTCAGTCGAGTaccgagcaccttaaaaagTATATTTGGCAGATCTTCACCGAGGAACGTAGATCTTAGAATGATGCAATGTGTA
CCGGCGAGCCATGACGGCAAAATGCTTTAACGAGAAACGGCTTGGGAGTATCTTCACCGAAATGCTGTCACCAACAGCAGCAAGTTGATTTATCTTGCCT
AGACGGTCTACAGAAGCCATAATACCGGTATTGCTGAGTGGTTATGTCATTGAAAAGAGCGGAATAAATATCGAATTGATGAACCGCCAGCAATCTACCT
AAATGTGCATTGTAGTAAAAGACATCAGCACGTGTGGCGAGGGTAAAGCCCAGTGACACGTTACACGCatgtgcacatatgtgccTTCCCGCTTTCAATG
TTACCCTACTAATATGTAGTGCTCGAACAGTGTGTATTGTATCCCCGAGTGGCCATGACATGTGTTTCGTAAAATTCTGTACATAAGATCCTCTTCGAGA
GGCACAGGTTCACGCTGAGTATCGCTTGGTTCAGTGAATAAATGAAAACTAGCCTAAGGCATAACGGTGCAGCTGTAATAGCGCGCACTTCGATGAAGAA
ATATATAGGCTTTCAAACTCCGTGCCTTCGCGGACACTACAACGGAACAATTGCTGCGTATGGTACGTAGGTTGTACGTGTCAACCCATCAATTGGCAAC
GTCACTATCGTCACAATCGACAGATCATAGTCGGGGCGTCGCAAAAGTGGTTCCACCACCATATTAAGCCAGTTCAGCTTCTACCTTGCCTCTAatttat
attttgcaaagaggAATGACCATCTTACCATTCCTTAAAGTAGATGTGGTATGACGttgctgtgcgcaacgacaCATTGAATATATAGATCGCAAACTGC
ATGGCGATAAGTTGGTACATCATAATTCGACCGAAACATATTTCGAGGAGATCCTTGTTAGTAACATTGAAGTTATCCTCGTTCGCCTTCAGCAATCGAG
GCTCAAACACAACTGCGTGTTCATCCCCATTGGTATTTACTTGACGTTAAGTATAACTTATGGCATAGCCGGCGTCAGAGGCAAGTGAAGTAGCCAATCG
TAGATAGAGCCAAAATTGGGGCACCGTGAGATGCTTGCTCACAACCTCGAAGGCTTTCTCTTAAGCCACGCCTTACAATCATACAACACTCCTTCTCTAA
GGCAAGCGGGGAGGCGCCATGCCATATTAACATAATTTGAACTGCTCTTGTACAGCCAATTTAGAGGTCGAGCCTTATACATAATTCCGGAAGGGGTATA
GACATAAGATGGCCTTGATCGTTGAATTTCTGCGTGTATGTCATGCTTTATATAGTTTTATCTCAGCAAAGAAATTTCACCAGCGCCAAAGGCATACTTG
ACTCTAGTGGCTAATGACTGGTTGAGCGTATGAACTTAAGCAATGCTTTTAATAGTTTCATTCAGCTCTCCACATCCGACGCCCTGAACATGAGCAAACG
ATACCGCgaaattgtttttttgcaTAGCTttaacaactgcgtcactagAGATTTGAGCATACCGGAGCATTAGACAGCCTCTGCAGCATAACATGACGGT
CTCAGGGCATCTTGCTCATAGGGTACAGCGTAGTCAAAGGAAATCGCTGTCCCGTTTGATGAGCACCATTAACCAAGTCGAGGGCACAAAGCAAAGTGCA
GCCAACCATGCTTCAAAGCAGTACTTTACGTCAAAAACTTGGTGTTCGTACTGGATAAGAGGGTTTAGCAAGCATATTACAAGCATGGAGTCGCTTGCTG
CTGTCGTTTGTGAGAAAGTCCGCGCAGAGTGTGGGGGATATGCGCGCTAAACAAATCCGCTTTGAGCTTCGCGCAGAGGGACGCGTCTACTACGTTACCA
TATTTTCTTGG