Description :
From Genome Similarity Track
Location :
Scaffold_347:20321- 21812
Transcript NameFunction/comments
Phymu_g8907conserved hypothetical protein
Phymu_g8908hypothetical protein PHYSODRAFT_252183

Sequence
1491 bases(100 bases per row)
GAGGTTCCCCAGTAACTGCGTCAGCACCGCACAGCCGAGGATAGCTACAacgtccagctgcaggaagGAGACCCCGTGCGACTTGTACACGAGACAAACA
GCGATGAGCACAGGGCACACAGAGGCGAAGAGCGTCCGCGGACGCAGAGCACTGCGCACACTCTTGGCGTACTCCATTTTCGATCTATGCGTTGTGTAGA
CCACATAATTGTTTTTCAATAATTCCAAAAGTGAAGGGTAAATGAAAAATAATCGAAATGCAAATGGAATAATTATTGATAAAGGCTTAATTGATGAGTT
CAATGCCGCCACACACACCGAAGACCAAGGAATaggaatacatgtacagtactgtagttGCTTTCGACGAACGGCACCACGCGCAGGATGACGGGACAGT
CCGGCAGAACCatattacatgtaccatgGTATTGCGTGAAGTTCACAACCTTGCCCAGCTCAACTCATGGCGAATAAACATCCACATCGCTTTAATCAAT
CCCATCTGGTGCCTCAAGATGAATTTCCTGCGGGCATCGAAGTTCGGACTTGGGAATTCGTTCGATTGTGTGATGAGCAAATCCGCGTATCAGCCATGAT
CATCCCCATGTGCTGGGTTTAAATGTTCACGACACCAACCACTTCCCAATTCTCCGAGTCGGACTCCAGACGAGCAGGATGCTGGAGAGCAACGAGAGTG
ATAATACAGGGCGGCAGCAGGACTTACAACGCAAAGACTCAGACACCCACCTCAGTGTCATCGAGATTTCGGATGTCGAGACTTCGACTACGGACTCAGA
GGACCACACATTCGTTGGGCATGCTAACGCCAGCACAAAGTCATCAGGCGACAGGGTTCCCGAGACTAAACCAAGTTCTGCGCCAACCAAAGTGGTGTTT
CTGGACGGTATTCGGGGTCTTGCAGCTATTCTCGTTgtcttccagcactcgcaCGAGTACCCTACGAAccaacttcatcttggtTCAATAGCTGTCGACG
CtttcttcgtgctgtcgtCGTTCCTGCTGACGTGGCTCTTTATGAAGAAAAGTATGAAGTTGTTGGACCAACGAGCGAGTTTCCGGTCATGGGCGATTGC
GTTGCTGGATTACTTGCAGAAGCGATTCTTTCGTGTGTATCCGCTGTTCGCAGCGACTGCGATCATTCTTTCGTGCATGTCGTTCGAGAACCAGCACCGA
TATTTTCGATTGAAGAAACCTGAGGATTTTCAACTGAGCAAGGTATTGCTGTTCTACACTGGATTCCGTCCTCATGTATTCTGGACACTGCCGCTTGAAA
TTGGTTATTACTTTGTGATCCCAGCTTTCGTCATGGTTGCGCTGGGTCTGCGTCGTTACTGGTGGCTCGGAGCTGTTCCGTTGTCGGTTTGGATTGCTCA
CGAAGGATTTTACACGTACCGAAACAACCACATGCCGCTGGCCCCACATCTTCAGACCTTCATGGCTGGCTCATTGGGAGCTGTAATGTTC