Description :
From Genome Similarity Track
Location :
Scaffold_10:203197- 213546
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004707Similar to TRYP7: Trypsin-7 (Anopheles gambiae)
Pytul_DAOMBR144PYU1_G004706Similar to Rv2228c: Uncharacterized protein Rv2228c/MT2287 (Mycobacterium tuberculosis)
Pytul_DAOMBR144PYU1_G004705Similar to Trypsin-2 (Fragment) (Salmo salar)

Sequence
10349 bases(100 bases per row)
TGTTCGTGCACACAACGGCAATGCAGCTAATACGTGCGCTCTATCACCCAGACTGCGTTCTCACGGTGATCTTCCTGCATGCTACGCACGTGTCGCCTCA
CCAAGCGCGAAAGGATTCATCGACAGCGTTAGTGTTGACCATACGTGGCGTGTGAGCTGGAACGCTGGTGGTATTGGCCGCGCGTTTCCGTTCCTGGCTA
AAGAGGTGCTCGCAATCACCCCGATCACGACTACAATCGTACCTGACGACCCAGGGTACACTGGCAGCCTCGAGTACGATCCACTTTCCTCCCAGACACA
GGTAGGCTTCGTGGTCGGTCTTCGCAAAGACAAGTCGGGGCAGAACTTCTGTGGCGGCAGTTTGATTGCGCCAAGTTATGTTCTCACCGCTGCCCACTGC
GTCGTCGGTGGGGAAGCAAAGTACGTCTCGGTTGGCTCCCGTGCATCGGCTGGCACGGAGACCGAGCTGATTCCTGTGAAGCCGGAAAAAGTGATTGTGC
ATCCGTTGTATGGGAAACGGTCCGGCATCTCGTACGACGTCGCGATCCTCGAGCTCGCGAACCAAGCGTATCCTGCTCCGATTCAGCTGGACAATGCCTT
GGCTTTTGATGCATCGACTCAGTTTACGCTGTTTGGATACGGCGCCAACAGCGCAGAAAGCCGAACGCTGTCTCCCGTTATGCGCTCCGTGGAGTTGCCA
TACTTTGATCGCACGTCGTGCGCCAAGTTTTTCCCTGAACTAGACGACAGCATGCTTTGCGCAGGCGGGCAACCTGCTCGTGACGCATGTACGGGAGATT
CTGGAAGTCCACTCGTGTATTACCAGGATGGGAAGCCTGTTCTCGTCGGTGTGGTGAGTACCGGACGCAATGGCTGCGGCACCCCTGGAGTTCCAGGCAT
TTACGGCTACGTATCCACCATGCAAGGCTTCGTCAACAGTTACACAGCAGGCTGCAACTGGGTAGATCCCAACAAGAGAGCGCCTTCCTTGGATAGTGCG
TTGAGCTTGTCGAGCACAGGAACACCAACAAGCGGATCCACTCAGCCAGAATCGGCGACGTCCGCTCGAACATACTTGGACGAAAGCAACGAGAATCAGA
TCCCGTTTGAGATTGTCCACAGTTCAACCGGAGTCGACGAGCACCAGTTATTGGTCGTGAAACTCGCGGTCGATACCCCACCACTGCTGCAAGATGCCGT
CAAGGCGTTCCTTCTAGGAGGATACAGCATGATCGGAGGTACGTGGGAGCGAATGAGCAACGAGATCAGAGCAGCCGAGACCACGATCACGTTTTACTCG
TCGGGCGAAATGCTCGACCTCATGAAGACGATCGCAAAGTACAGCTTCAAGCCGTTGAATCAGCGAACGAACCGCTTCGGCACTCGCTTTGACGAGACGA
CCAGCAGCGCGAATTGTTGCGATCGCGCGTAGACCGGGGCAAGGCAGTACCAAGAGAACAGAGCGGCAGGTATAGAGAAAACGAACCAATGTAAGCTAAG
ATTATATAGTAGCAGTTGCACGATTTGGTCATGGCCTTTCCCGTTTTGACGTAAAGTTGAACATGTTCCAACATGCTTTGATATTTCCAATTTACAGTGG
GCGGGGGCAACGAGGACGCTTTTTTACACCTATCGCTTCGTCTTGGTGAGACGAAACGATCCAGAAAGATTTGAACAGATCCCATCGAGTGGTTCTGCCA
GAAATCGCGTGTAAAGTTTTTTCTTAAAAAAGGATTGGGCACTCCTATTAAAGGGTTTTGACTAGCTCCTAAGCAAAATAAATAACTGAAGTTATCCAAT
AGAAATCACACAATAATATATTACTAAACATTGCTGGATAATCAAACAGAGGTGTTGTATTTTTGGTAATTTTGCACCCTGATTTTCTCCCACAAAACCC
CTGTTACCTCTATAATATTGTGCTCTGAATTAATATAACATGTTGCCGTGTATGTAGTGCTGCAAGGTAAATACGCGATGTTTCTTGATTGAAAACACGA
TAGGGATTGGTTTCATTTGTTAACATTGCGCAGATACAAAATACGTCTGTCACTCAGACTTCTTTTAGAGGGCATAAACAGCCAATGATATGGAGCATTC
CTGAAAACGCGGTCACGATTGGACAAAAACTAAGTGAGTCGGACTGAAAAGCGTCCTTGTTGCCCCCACCCACTGTTAATAAAACCAGTTGTGGTTTTTA
GTCTGATAGGGTTGGGAAGCAAACCTGATTTTTGGGCCAACAGTGGGACCCGGTTGCAAGAGCCCTGCATTGCTCTTGTGGCCGGTGTGATGTGTTGGTG
CACCTAGCAACTGAACGGGTTTTCATGCTGCAAAGATGAGTCTGGGCTTGTGCTTCAGCAGTGAATTTTTGATACTGATCTACATGCTGCTGTGCGCTTC
CATGCGAGATTTTTTCTTGTAATGCGCAGATATTTTGGCCTCGCGCGTTCCTTGCAGATGTAAGTAGCGTCCCACTTCGTCCGTTTATGCTGGTAAAGTA
TGTGACTGTCGGCACCGACAGTCACATATCAGTGCTCTGCTGTTCTGTACCCCAACTCGCCTCAGAATGAGGAAATGAACCATGGATAGGAGCTTCCATC
TGATTCACCATGCCCGTTGGTTCAGTTGGTTCAGGTTCTCGTGGCCGTTTTGGCAGCAAATACTAGAATGCAGTCGAGCCCATGGGTAGTCTGCCTATTC
TCTCCTATATCCTGACAGAATTTATGGACTGGGCGATGAGCCTTGCACTCATTTAAGTTATTTTTAGAAATGCGTAATCACATGCACATCACACTGAATG
CAAAGCCTTGCGTATGCTAGTACAAAATGGAGGGCTCGCAGCGGACATGAAATATTTGAGGTACTCAAAAATCAAGATGTGCATCCTTGGATACAAGATC
ACTTACATCTTTTGCAAGATGCTCACACCAAGACCCAGCGAGCATGCGTGACCATAGAGCAAAAACTGCAACTTTGCAGAGTCGCAAAGCTGCGACGATG
CACCTACGAGCAACTAGCCGCCTGGGCCAACAAGGAATTTGAGCTCAAAAAGAGCTGTCCGATTCCACCGCGAGCAAAATCGTTTCCCGCATCAAGAAAT
GGGAGCAGTTGCCCAAAAGACCTTCAGCATCTTCACAGCGATGGTCTGGGCTGAGTAAGCCTGGGATGTGGTCACTCCAACGACCATTATAAATTGCTGG
CTTCATCCAGGCATTGTTTCCGGTCGATTTAGAGTGCAAATATCACATTTTCTTAATTCTTTGAATATGACAGAGCTCATCAATTAGACATGACATATTT
GCAACTAAATCAATACATAGTGGTTTGTCTATGCAGCGCAAAACCAATAACCCTGCATTTTTTATCGGGACCACGTTCAGACTACTCGTGGGTTTGACCG
CAGTACCGTTTTCAATTTTTTAAAGCGTATATTCGTAGACAGCGCAAGCAGTAGCCTACCCGGCCTCGTTTTGGCCAAGCATGGATGAGACTGTAGCTTC
ACAAAAGGCAAACAGGAGGTCCATCGGTCTGTGCGTCTCACCCTTTTCATTTGTTCATTCGCCGCCCAACGGAGACGTTCGCCCACGCACAGCGCAAATC
ACCCGAATAACGAGACTAATTCCAAAACACACTCGGACGGGGAGCACGTCGCGTCGCGTGCACTTACCTCTTCCAGCATGCGGCTCGCGATTTCAGCTGC
GCTGCTCCTCACCAGTCTTGTCCATGCTGCGACTGAAAATGCTGAAGCTCCGTCTCGAACAGATAGCGGGGCACCATTCTGTGCCGGGTTCCAAGTCACA
GAAGAATATTTCGTAGCCACTGCGCATTGCGCAGTCAACACGAATCCGGCAAACGTAGTCGTGATCGGAGACAACCAAGTGCCCGTCGTACTTCCGATTA
AAACACTGCAGGTGTTTCCGCCGTATGGAGCAGATACAGCGTCAAAGTGGTCTTTCAATATTGATCAGGGCGAGTTGACAGTCCCCATTGCCGTCGACAC
GTCCTCCATCGTATTCGCTATGTCAGCATTTAGCCGTCCGGGCCAGCTCTGGTGATACGATATCCAAGCGAAATCAATGGATGCTGCTGCCAATACGAGT
GCTTCAGACACACCCAAAGATGATTCAAACAATGGGCTGACGGTAGCACGAGTGAAGGTCCAAGCCATGGAGAATGCGCCGTGCGAACTTGCTGCTGGTA
TCACGCTTCCCAGGGGTGTACTTTGCGATGCAGTTGACTGGACGAGCGTTGACAAATGCGCGGATGCGTTCACGAGTGTGGTGAACGACCACCAGCTGAT
TGCGATCGAGCAAGCCGGCGTGGAGTACGCGTTTGGGTTTGTGTCGGAGACGTTCCCGTGCGACGAGCACGGCCAAAGTTTATCTGCTATCACTGTGATA
GCTCGCGGTGACGGTACGAAAACTCAAAATGATGCCATACTAAAATGCACTTTTTACCTGACTATGTTTTGCTGGTGATGCTGCTGCTGATATGCAGGTT
CTGACACTTCATCTGGTGCTTCTGGCAGCGGCGATGAATCATCTGGCTCATCCGGCGGTGCCAACCCACCATCAGATGGAGGATCTAACGCAACTGGATC
AAGCGTGAGTGCAGTTGACGAACAAGCGTACTGCTTCGGATACCTGATCGATGAAACACTGTTTGTCGCCACCGCGCATTGTGCCGTCAATTCACCCACA
GCGAAACTGGTCGTCGCTGGTGAGCATCAGTTACCCATTGCCCTACCCTTCAAGACATTGGAGCCGCTGCCGGTATATGGATTTGGTGTCGCGTCGAATT
GGTCTTACAATCTTGCCGAGGGGACAATTGACACTGCAATTGATCCAAGTTTGCCCGCTATTGTATTCGACAACGAACTTGCCGACAGAGTAAGTTTACC
AATGAGTCCATTTTCCATCGATTCGACGTGCGGATCAAAACAAGAAACCACACTTTTGCCAATTCATCACTGCATGATCCTGATGATTATTTGGTTTTAA
CACAAACCACGACCAGTATTGTCGGCAACAAAAAGTGTGAAGCGGCTACCGGCGTCCTGCTACCGATTGGTGTTCGTTGCGGTGAGACTAAGTGGACGAG
TATGGATGCATGTCTGGAAGCGGTCGCAATCCCAAATGATCATCAAGTTATCACGTTTCAGCAAGACGAAAGGGAATACGCATTTGGCTTTGTCTCAGAA
TCATTCCCGTGCAACCAACAAAGCAGCAGCAATTTGTACATCATCACGGCGTTCGTTCTCCTTCGTTCAGACGGAGGTGCCTCCCAACCGCTGGGTGGAG
AGTCCAATTCCGGCGCCGATGCCATTGAACCACCTAAGTATCGAGTCATTTCAGACGAGATATTTCAGTCATCTATTCGCTACCCGTTTGCGTACATCTC
CGACACTCTCAATGCATCCATGCAATCGGTTGCTGCGGTCCTGATCTGCTCCACGTTTGTGGTGGCCAACGCGGACTGGGTTCGAGACGCAGCACAACTC
AAGTGGGTGCTTTTTGAAGATGACAAGATCGCCGTGAGGGCAGTGTCGTTTGAGGAAGACGCTAGGAACACGTATGTGACGCCATCGAGTTATCTGGTGG
TGGTCGAACTGGAAAGGCCGTATACGCGTGCAGGCATTCAGCAGATTGACGTGGAGCTAGCAGTGTTTCTCCCGCCAACTGAAGATAAGTCACAAGCGTT
TGAGTTTCGATTCCTGGATCCCGTATTGCTCCCGCTCGGGTTGCCAGTGGACCATGCTTCCCATCTGGCGACACTCGGATTGTGTGGGCTAAGTGACACT
GCAACTGATCAAGACGGAGTGTACTGCATCCGCTCGTCTTTCGAGAGCGTTAATGCACCTGCTGTTGGCACCCTTCGCGCATGGGGTTCGTTCTTTACGA
TGACAAGCTGGCCGGCATTCAATCTGGCTCGACCAAGTTGGCCGACCTTACGAGTCAGTGGTTCCTCCACTTTGGTTTTTGGCGGCGAAGAAATTTTATC
ACGTCAACAACGCGTGATTCCATATTCTGGAACGAATACAACGTGTTCTCCCCAGCAGAGCTGATGCAGCGTAGTGCTGTCATCCGTTTCTTCGGTGGAG
GTAAATTTGTGACGTGTGGCGGCATGCTGATTAGTCCTTCATTTGTGCTGACGACAGCGTCGTGTTTCACGAGCAACGAGGTCCTGTTCACAAGTTTTGG
AAGTGGCAAGGCGAACGAAGTGGTTGCAGTCCGACCGGGTGACATTGTGATTCATCCGCAGTATCAAAAAAGCAACGGCACTATTGGGTCGCGTTTCGAT
TTTTCGATCCTCAAACTCCAAAAGCCGTACCCAGCCTCCAGCGTGATTGGGTTGGCACCAAGTCAGGCCGCAGTCGGCTCAGACGTGGTCCGCGTCGATT
TATCTGATGCTACTGGTGCGGATCAGTGGGTTGTTCTGAACAGCAACCAGTGCGTGGATTCATTGGCATATGGGAGCAATGGAATCATTTGTGCTGAGAG
TAAAACAGTCTCGGTACCAAATCCGACCAAAGTGAACAATCGCCACGCACTGGTCGGCGACTACAATGGCAATCTGATGTTGTTTGGATTTGAAACTGGG
CCGCCCGGAAACCATAACGCTACCACGTATGCCAGCGTTCTTGAAGCAAAATCTTTCGTGAAGGCGAATGTTATGAGTGATTTTTGTCTATTTGACTGCA
TTGCGGACAAGATCTCGCAAGCGTCTCTTCGACCCCCGTTTGCGTATTTGTCGTCGAGCATGAACGTGTCCTCGGATTCGGTTGCAGCAGCTCACATTTC
TGCCGACGTAATGGTGACAAACGCCGAGTGGATTTCAGATGTGAGCTCGTTGAAATGGGCCATTTTTGGCCATGACAAGATCCGCGTGGACAAGGTGGTG
TTTGAAAGAGATTTTTTTGGCAATGCTTTGCCGAATAGCAGTCTTGCGGTGATCCTGCTCCAGAGCATTTACACTTCACCTTCACTTCCGTCATCTAGCT
CAACTTCTGGACAATTGGAGGCGACATTTTTGGACCCAGTGTTACTCGAATTAGGTGCTTCAGAAAACATTCGCACTGAGTTGGTCGCCTTGCAATCGTG
TGGACTCGACGATGCTGCCGGAGTGAAGTGCGTCCAGGCCCAGCAAACTGTGACTGCTTCGGCCCAGACAATGTCCGTAAAAATGGGGTTTGTGACGTCA
AACGAAAAAGTGGTCGGTGTGCGAGTGGGGTCAAAGACTCTGAACAAGGAGATCAACGAATCCTACATAGACCTGGACTTCTCGTTGCGAAAGATGCTGT
TAGGCATAGTATCGGAACTGCTGAGAGACCCCAGTTATGACACTGCTGCTGCCCGTCTCATCGAAGATTCCAAGCTGGTCAATTGCGGAGGAATGTTAAT
TGCTCCAGAATTTGTGCTGACGACTGCGACGTGTGTGCTGAGCCATCCGAATATTGTTAGAATCGTGCACAAGGGAGAGGACAAGGCCAATATCGTTGAA
ATCCTCCGAGACAGTACTGTGATTCATCCAGGATACAAACACGCCTCCGAAGGCGTGCCCAAATTCAACATCGCCCTCATCAAGTTGGGAAGACCACTGC
CATGCCTTCTCTCAGGGCTACGTAACCTGAGGCGACTGTTGGACACATTCGCGGAAGGCGCTAAAGGAGCTTCCTTTGTCTCAATGGTACAGCTACTTTC
AGAATTACTCATAAAGGACGCCTTACCTCCGATCGAGCAGCATTTCTCGGGCACTAACGAGTTCATCCTCTTCTTCGATGGGGGCTCACGGGGCAACCCC
GGGCCAGGGGGAGCTGGTTCGGTGATATTGCGACTAGACCGAATTGGCAGGCGCGCACACCTGGTGTGGGCAGCAAGTATGGCGTATGGTCAAGCATCTA
CCACAAACAACACTGCAGAATATTGGGGTCTGATAAACGAATTGCGGTACGCGAAGGCGCATCAGTGTCAGCCGCTTCACGTTGTTGGAGACAGTGCGAT
GATTATTCGTCAACAACAGCTCCACTATCCCCCAAAAAACCGTCGTTTGGCGTCCATGTACCACTGGTCCAAAAGGCTAGCGGATACCATGGTAATCCGA
TCTTGGTCTCATCACTACCGATCTTTCAACAAAATGGCAGATAAAGCAGCCAACCATGCCATGGACTCGTCCGTTTCGGCGCAGTATCGGTTTCCGACTG
ATCGCCGAGAAGGAGCAGAGCTCGCAAGCTTAATGGTAGGTGACACCCAACATTGGTTCGACAACCACCCGACCGCGAGTGGCGTCGACCGACTGTCTCG
ACACGACCAAATGGCCGTGGCGAGACCTTTTATGCGTTTGATGTGCTAGATCGTCATGGAATGGTGCCGCAGGCACCAACCATGACGATCACCTTTTTTA
CCCTGTGTCGAAACTTCTCTATAGTGTAGCTCAGGGAATGGATATTGTCGTTCGCCACGCGTAACATAATATACCTTACTTACTTCCAAAGACCACTGCC
AAAAGTATCTGCAGTCGCATTAGCACCATCGCAGCAGTCCATCGGTACAGAGGTTGTTCGAGTGGACTTGAGTGGGAAAGATGATCCGGCGGGAGCCAAG
GTGAAGTCGTGCGGCGGCGACGACGGAAAACAGCTGACCTCTGGGATGATATGCATTAAATCGTCGAGCACTATAGCTTCATCAAATAGCGCTGCTCTGG
TCGGTACATTTGACAATGAGACGACGACTGGTCGGTCTGCAAGCGAAGGAAATGCTGAACATTTACACCGCTGTCTCAGAAGCTGCGAACTTTATCAACG
GGTTTACGTACGGACAAGTGTGGGGGAAAGGCGTCGCTTACAACCCGTCGACGACTTCAAATGCGGTCGTGGGGCTATGGATCACGAAAACGGGGCAGAA
CTTCTGTGGCGGGGCACTCATCGCTCCTCACAGCTGCTCACTGCGTCTCGGATGGACTGGTGAACTGGGTGTCTGTTCGTCTGGTCAACTCGAGGGGCGA
GGACGAAGTGATTTCAGTGAAGTCAAAAAGTATTCGTATTCATCCCAGCCTCCAGCAGCCAAACATGTACTCCTTTGATGCAGTGATCATCGAGTTGGAT
GGGTCATCGTATGGCACTCCAATGGTTCTCGACGCTTCAACAGACTTCACTGACGGTGAGCTGGCAAGAATGTACGGATATGGCACGGCAACGACATCCA
GCAGTGCGGTCGCGCACGTCCAAGAGCTGAAGCTGCCATTATGGTCGTTCAGTAAGTGCCAGAAAAGGATAAGTAGCGTGGACAGTAGCGTGGACAGTAG
CGTGGACAGTAGCGCGTTCTGTGCCGGTGGGGTCGTTGGTCAGGATGCGTGTGCCGGAGATTCAGGAAGTCCAGTGGTGATCGACGGGAACCCGACAGTG
TTGGTCGGACTCGTTAGTTCAGGTTACGGGTGTGGTATGGACGGCATGCCGGGGCTCTACACTCGAATCTCGAAGATCGAAGAGTGGATCAGAACTCACT
CTGTGGGGTCCAATGGGATATATCGAGATACACTGGAGCCGTCGTCTTCTTCGCCTTCAAGCGCTCATACTTTTTTATATGTAAGTAAGGTATATTATGT
TACGCGTGGCGAACGACAATATCCATTCCCTGAGCTACACTATAGAGTAGTTTCGATTCAAGCGCTCATACTAGCTCGCCAACACTGAGCAACAATGTCC
CACTGAAATCGGCTCCGTTATCGGCAAAACCAGCCTCTTCGCCGGCACCGTCTGACTTGCGTTCACATGCCGAAATTGCAACGACGAGCCCCGCACCCGA
TACAACAGTGATTGTGAGCCAGCCAGTGCCTGATATCTCTCTGATCACGAAGGACAAAGTGGTGGACTTTGTAGTCTTCGAGATCTGCTTACGAATATTC
GCAACAAGATCACGTTGTACTCTTCGGGGGATCTCAGCGGAATCATGCAAGTGATTCAGACCCACGATGCGCTTCCGCTGAACCAACGAACCGATCGATT
TAGAAATGTCAGTGCGCGCCAACAGGGTGACACGGTCCAAGCACAGAATGACGTTTGCGCACCCATAACCTTAGTAGCAGGTGCCTAAGCTTATGCTCGA
AAGCCGCCATCAGTAAACAAGAAGCTCACCATTCCGAGTTCTTAACCCAACTAAAGCATGATGGCTGGACGTCATACGTTGGGCTCTTTAATCATCACTA
TCAATCTTGAGAGACTAGTTTGCGAGACTGGTTCAGCAACCAGTTTTCTGTAAGGCCATTGAGTTCTCCGGTTGAGTATAGCGTAATGCTTCTATCAGTG
TTCACCAACTTGCCCGATTTGTGGACGCCGAAATTTGCATCATTGCCGC