Description :
From Genome Similarity Track
Location :
Scaffold_6:2031969- 2034392
Transcript NameFunction/comments
Physo_514002pectate lyase
Physo_512552Hypothetical protein

Sequence
2423 bases(100 bases per row)
GACGCCATCTACCTCCAGGGTCTGGACCACGGCAAAACCGCCATGAAGAACATTTGGCTCGACCACATCAAGGTCTCGCACGTCGGCCGACAGTTCCTCA
CGACCAACATGGCGAGCACCGACTCCCTGACCATCAGTAACTCGGACTTCGACGGCAACACCGACTACTCGGCGTCGTGCGACGGACACCACTACTGGTC
CTTCATCTTCTACGGCACGACGCAGTTCAGCATGCTCAACAACTACGTGCACGGCACCTCGGGCCGCTCGCCTAAGATCGGCGGCGAGCCTGACATTCGT
GTCGTCGCGCACGTCGCCAACAACTTCTGGGGCAACAACTCGGGCCACTCGTTCGAGATCGGTGCCAACGCCTGGGTGCTCGCGGAGGACAACTACTTCA
GCAACACGCGGATGCCCCTCTTCAACAAGACGAACGACGGCGCGCTGTACGCCGCGGGCAGCGCGGACGAGTGCAGCAAGTTCCTGGGCCGCGCGTGCAA
GGCCAACGTCCTGGTGAACAGCGGCATCTTCCCGTCGCGCAACGGCGAAACCGCTCTGGAGACCATCAAGTCGGTCCCTACGTTTGCCAAGTTCGCTTCG
GACTCCGCTGAGGCTGCTGGCCCTGAGCAGCAGACGGCCCAGACCAGCGGATTGGACCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAGGAGCAAGTGG
AGCAGTCCACTGCTGGCACGGTGAAGCCGTCGTCGGTCCAGGCGGGTCAGACGTCGATCCAAGCCAGCGAGGTGGAGAGTGTGTGGGCCGAGACGACCAG
CAACTTCGGTGTTGGCAAGCTCGACTAAGTGGGAGTTGTGTGGTAAAAGTGCTAGAGGCACCGGCATCCATTTGATTCACAATGACCCCAAGTAGGATGT
ACTGGTATCACAAGTTGTAGTTACCGATCGTATGCATTCTAACGTACAAAATATAGTTGTTTGATACTTTGTCGAAAAAGGTCGTATGCATTCTAACGTA
CAAAATATAGTTGTTTGATACTTTGTCGGGAAGGTTTAACCAATGAAGTCAAAGTTTGCAGGAGGAGTGTGTCGCTTTGACTCGGCGCGTGGATCCCCGA
CGGATCGTCCTATGAAGCGCCGCACAACTTGTACGCGGCCGCTTGAAAACACCACCGGTCTTCGGGACAGGAGAGTTTGGCGGCTGGTGGATTACAGTCC
GTATCCACGTCATTTCGCACGAACGTGCTGTGCATGTATGTACAGTACCAGCATTGGATGCATGTTGGCAGGGAACACCGTATCTAGTCGAGGGAAACTC
AATTTGTCGTTGTAGTCGACCGAGCTTCGCCATTTTCGCTTTCTATCGGACCATGATGCTATAATACTACAAGGTTTGGCTCTCACAATGCACCTCTCCT
CCTTCCCTACAGCTCCCAGGCAAGCAAGCTATCTATCTAGATACCTGTGACGAACTTCAGGCTGGAGGGGTCTGAGAGTGCTTACGTACACAGTCTTTTT
TTGATGGGGGTGGTGAATGTGATATAGAAGAGGACCAATGGAGGCTCGCGGTTGCGAGGAGCGTAGCCGCAGCAAACCCGCGCGAGGTGCCCGCGTAGCA
GGGCCGCGCGGTATTTGCGGAGGCGGGCCCAGCGACGAGCATTCCAGCGAGCCGAGCACTGTTCTCGCCAGGTGAGAGAATCTTTTTATCGCAGGAGCGC
AGCGACTGCCTTTGCGGAGCGCAGCGGAGCAAAGCCATTTCCCGCGGATGACATCCGTCCTGCGGGAAGGTCGTCACATTGTGGGGTGATGGGCTGCCTA
TACAAACTCCAAGATATCACCGAAAATAGACTGTGTACGTAAGTCCTGCCGGAGGGGTCTAGTTTCTCTTCTCGGACGGTCGAACAGAAGGTATCGACTG
AGACAAGGTGTCTCTTGTGAGTCAGACGGAAACCGAGGAGAGATCAGCTATCCACAACCACAAGCGAGCGCTGGCTGTACCGAGCGGGCGGGCGCCTCGA
GCTCGCAGATTCTGACGCTGTCGATAGCAGGCTCTCGTGCTGCAGTACAGCAACCTTTTACAGCACGGCGATCAACCAAAACAAACAAACAACTATAACA
TGCATATCGTGCTGTACAGTAGCTGTATTTGTGAGTGCACTGCCTCACGCAAATCGTATCCTTCGATCTGCGCCAGCCGTATTTTGCGACTTGGCCTCAA
CAACTTTCGCGACGACAGGGTCGATACTTTCATATTTGGTACGAAATATCATATTTCATATTTCAAATATGACAAGCGGTAGGGATTTTCCCAAACTAAG
ACGGGTCCGCAGTGCGGACTCCGCAACAAGGATAACCTTGCCGTTTCAAGCGCGCACAACCTGCTAAAACAAGGTGAAGTGGCTCCTGTGAACTGTGAAC
ATCAATGATTTATTTTTCATCTC