Description :
From Genome Similarity Track
Location :
Scaffold_88:2031- 3576
Transcript NameFunction/comments
Phyag_g1834Amino Acid/Auxin Permease (AAAP) Family

Sequence
1545 bases(100 bases per row)
TCACTTTCCAACTCGCCTCCTGCCTCTCAAGTCACCCTCAACCAACTTCGCTGGCTCCGTCGACAACCATGGGAAGCAATAAGTTCATGACCCTTGAAGA
CTTCAAGATGGCCTTcaacgtcttctgctgcgtctacGGTGTTGGAACGCTTGGTATGCCCGGCAACTTCTCTCGTGCCGGCCccgtcatcgccatcatt
GCCATGGCCTTCATGGCATTCGCCAACATCTACGCGTCCGTCGCGATTTGCCGCGTCATGTTGCTGGCGCCCAAGTCCGTGCGCACGTACGGCGACCTGG
GTCGATGGGCTGCAGGTAGGTGGGGACACTGGTTGGCTGTCCTCTCCCAAATGGCTTCGTGCCTGCTGGTGCCCTGCGTGTTCCTGGTGTTGGGAGGCTC
GTTGCTCAATGGGCTTTTCCCGGGTGCTTTCAGCGACAAGGTGTGGATCATattgatggcgttgatgtGCCTACCGGTCTGCCTTATCCCAACGCTCAAG
GAAGGAGCGGGTGCTGCATTCGCCGGCTGCCTCGGCACGGTCCTCGCCGACATCATCGGTGTGGCGGTTGTGATGCACGGCATGCGTGGACACCCGTCCG
TCCCTGCACCGGAGCTTGAGTTCGAGCAAGTCGCCGGTGTGTTCGGTAACCTCTCGCTCGCCTATGGTGCTGGTGTGGTCATCCCCgctcttcaacgtca
acacAGTGAGCCCAAGCGTATGCCCCGCGTCGTTTTCTTTACGATCACTCTTATCTCGAtcctcttcttggtcttggccagcactgcGTACTCGTCGGTT
GGCTGCCAGATCACTGGCAACCTGCTCTTCTCCATCTACCCGAACGCTGTCACGGGTCTCACGACGCTCGGGTTCAAGTCAAGCTGGGGCGCTGTCGTGT
TGGCCTACCTCTTCATGCAGCTGCACGTGACCATCGCTttctcggtgctgctcaaccCGCCGTTCTACCTGGCTGAACGCATTTTCCTCGGCATGCACAA
GAAAACCGAGAACGACATTGAGAACGCAATCACCTACGCCGAAGTCACCACACCCGGCAAGGACAAGGAGTCCGTGAACATGGCGGATCGTCGATCCAAG
ATGTCTTACATTTCGGCGGCTGATGCTGAGAATCCACACTatggcgatgaagaggcCGAGGAGGCCGAGTACCGTGGCGCCAATGCCATCAAATATGCGC
TTCTGCGTATTGCCATcatcgtggtgctggtgatccTGTCCATTGTGCTGAAGGACCATTTCTCCGATCTGTCGGACTTTGTGGGCGCGTCGTGCATCTC
GCTTAACAGTATCATCCTGCCGATTGTGTTTCTGCTCAAGAAGTGCTGGGGCACCCTCCCGATGTACGAGAAGATCCCCGCTCTGATCGTAGTGGTGGTA
TGCTGCGTCCTCGGCTGCTACGTGACGTACACGTCGGGTAAGACGCTGTTTTCCCCCACTGACTCGAGCGTGGAGTTCCCGTTCTGCGATTCGGAGTTTG
AGAACAAGGTGTACTACAACTACACCGCCGTGCACGGTGCGTAAG