Description :
From Genome Similarity Track
Location :
Scaffold_2092:2031- 3073
Sequence
1042 bases(100 bases per row)
GTCGAGTAATGCGAGGTGATGAGCAAGGTACCGATGATTCAAGAGAAGGATGAGCTGACGTACCTCCAGCTGTTCACGTTCGCGACGTCTACGGGGATTG
AGATGCTGAAATGCGTCGGACACGACTCGATTCAGACGCTTGGACATACGGTGGCGAGATGGTGAATTGAAGAATGAAGAAATGTCACAACGGGCACCAG
TACCGTGGCTTCCATTGCGACAGGGGCAGTTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGATG
TTCAAGCGACGAACCCTCGGTCAGGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACTCTCGAGCTTTCAACAAAGTACCGGATACGG
TCATATGTCACTGAATCCAGGCTGTCCTTATTATTAATAATGGGACTGGCCGGATTCGCATTCAGCGGACCATCTACGGTACGAGCCCTCAGTGGCCGGT
TGGGATGAGTTCGCGGAAGACTCAGCGACCCTGGAAAGGCCACGTTTCCCGTCTGGGACAGGGGCGCGGACCGTTAAAGATGCTCATGCGACGGTGCAGA
CGACGCTTGGCATGCAAGAAGATCCATAACGGGATCATTGTTCACTTGATATTTGTATACTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTA
AACATAAATACAGAACAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTC
GGTGAACTCGAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTTTGTGTCTTGGCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTG
TTGCCTATTTGCACGACTGGGAGTGCTTGAATTGCCTCCCTTTTATTCTTCCAACCGAGTGTTGAACACTCGGTGATCTCGTAAAAGGCTTACCCGTGTC
TGGTACCCTTCCGCTGCTGGGACCACGAGGATTCATAACACA