Description :
From Genome Similarity Track
Location :
Scaffold_191:20304- 25275
Sequence
4971 bases(100 bases per row)
TCACCGGAAGAAGTCTCGCACTGGTGATAAGGCCTAAGGCGACCGACGTAGAATGTAGGATGCATGCGCATCTTACGTGGCAGTTCAATCGTGTATACGT
TGCCTAAGCGGCGCAGCACACGAAATGGACCGATGAACTTGGGTAGAAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAGGTTTACCGTAGA
TAGTAGGACTAGGTCACCTTCATTGAATGAAAGGACGTTTGCTCTTCCATTCTTGTCAGCATTTTCTTTTGTCGGTCCACCTCTTCTTCAATGGAATCTT
GCACGAAATGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTATCTGACTTTGGCTATAGTGCGCTTGGAGCGCACTGCGGCAAGATCAGT
GACCTGGTTAGTAAGATCACGCTCGCTCGTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGTGCCATACGTAGTGACCTCGTGGTCAGTA
CGCGATGAGTGAGAGCCGAGTTGGCGTTCGCTCGAATGATTCCCTCCCCCCTCAAACTAGAGTTACACTCTAAGAAGGTTGGTAGTCGTGGGTGGTGCAA
GCCATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCAAGTTGTTGATGGCGAAACCCACCATCGGCAAGAATTCGCTCCAATTCGTAAACGAA
TGGACGTAACCCCGAAGGATTTCCTCAAGAACGCGGTTGGCACGTTCTGTCTGACCATCTGTTTCAGGGTGTTCAGAGGCCGACATCTGAAGGCGAGTTC
CGAGTGTTTTGAACACGGATCGCCAGAACTCAGCAGTGAACCGTGGGTCTCGATAGGAGAAGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTC
AATAAAAACACGAGCACATGCCGATGCATTGATAGATTCAGGTACAGCGACCAGGTGCACCATGTTACTGAATCTATAAACGAACACAAGAATACCTGTA
TTCTTGTGTAGGTCTGCGGGGAATCCAAAGACAAAGTCCATTGAGACTGATTCCCAGCATTCTGCAGGAATGGGCAAGGGTTGCAACGGCGCACGAAGTG
AAGGACCAGAATTCACTCGTTGACATACTTTGCATGCGGACGTACTTACGCACGAACTGATACTGATGGGTCCAGTAAAAGTCGCGACTAACTGTGAGAT
ATGTCTTCTCTCGACCACGATGCCCACCAGTAGATGCATCGTAGTACTCATACATGATGCGCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGAGG
CGTATCGCCGGCAACGGCTGTATACTTCAGTAAGCCATTGTGGACTATATATCTATTCGTGGAGGATCGGTGTACTGGGGGCAACAATAAAAGGGATTGA
AGGGATGGTTGCGAGAGATGATCCATCAAACGCACCATCGCCGGATCGTACGCCTTGTGTATGTCTTCTAGTAAGGTTGACGACGGGACACTCGACGTCA
ACACCGCGACAGTGGTCGGACCAGTGTCGGGTTGCGCAGCCGGTTCGAAATTGGGCCGGCGCGACAGAGCATCAGCGACGACATTCAGTCGTCCTGGTTT
ATATTACACGGAGAAGTTATACTCCGCGAAGAACGACAACCATCTCGCCATTCGTTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACACATGG
TCCGTGTATACGATGAAGGGTCTATCACCTAGTAGGTGGACCCTAAATTTTTCCAAAGCATACTTCATGGCAAGGAGTTCCTTGTCATGGACTGGGTAGT
TACGTTCAGCTGGTTGCAGCTGACGTGACTGATAGCAGACGACAGGCTCAGCGCCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACT
TGCATTGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGTTTGATACCTACGAAAGAGCGCTGGCAA
TCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAATTGAGAAAGATGAACAGTCATCTCGGCGTAATTATGCGAGTATTTGTGCAAATACGCCGCTA
GGCCAAGGAACTTTCGAAGTCCTTTTATGTCGGTAGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCGGGCCGGACGCCGTGCTTACACAC
GATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATACACTTCTTGAGATTGGCATACAACTTATGCTCACGCATCAGTGTAAGAACTTTCCGGATG
TGGAGTCGGTGGGCTTCCAAATCCGTCTGTCCATCCATAGCCTGGCTATGGACGAACACGTCATCGAAATAGCTGGGTGCGAACTCTCGCACTGATCTCA
ACAGATTCGTAACACATCTGTTGAACGTAGCAGGGGCATTACTCAGCCCTTGTGGCATTACTAACAACTCCCAAAGCATACCGCTTGGGGTGCTTACTGC
TGTGTAAGGAATGTCCATATCACGTATAAGGATCTGATAGAACCCGTCCATCGGATCCATCGGGGAAAAGATGGTACTCCTTGCCATACCATCTATAATG
ACATCCTTTCTTGGTATCGGCGTTCGGGTCGGTACAGTGGCAGCATTCAACTTGTTGAATGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGGACAC
AGAAAGTCGGAGAGCTATGTGGGGAAGTAGATTCCCTCACATAGCCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTATTACTTGTTCACGAGG
CAGTGGCCATTGCTTCATGACACAGTACTTTGACCCTGGTTTCAGGTCTATCTCGTGACGAGTACCCTTATCCTTGGGTAGCTCGCACGGTACTGTTTCT
GGGAACACGTCCCTGAATTTTGTCAAATCATCGTAGAGTAGATTTGTCTTGAGCGTTTCCCACGATTGGGATGTATATCGCTCAATCCGAGTCTTCTCAT
CAAAGACACTCTAGTCCATTGATGAGCTGCTGAGAACCCTTTCTTTCTCAGCGAATACCATTGCCGACTGAATGTCGGTTACGTACTCGTCTTCTGCGAC
GAGTACGCAAATTTGCTTGACTTTCCCACTACGCAGATCATGCAAGAACCTCTTCTGTTCGAGCGTGGGCAATTGATTGATCTCCGAAGTTGTCTTCGGA
GGCGAGATCAGATCAAGTTGGCTAGTTTCTATGCTTGATCTGTCATTCACTAGGACATTTAATGTCTCTGTTGGCTCCCGGGAACTTATTTCCACAGTTG
GGTGGGGACTTAATCCCTTACTAGCCTCTTGGGATAAATCATCATATGATACGAATGGAATTGCTCCCTCGCTATCTTCTGGCGGTGGTTGCGCTACCGC
GGCCAGGTATTCTACGTCCGATTCTCTAATCGCACTAAGATCATCGTATTGCCAATCATTGGCAATCGGTTCGTTTTTACTTGGGTGTTGTCTGCTTGGA
GGACACCCATGCCCCAGTCCACTCGACTTATTCGGGTGGTGGGCCTTCGGCGCGACCTGCATCTCAATGCAGTCGCCGGAATCTGGCATCATGGTGTGGC
GATCAGCCACTCCATGGCCATGTGCAGTCGTATTCACGACCGAACCACACGCGAGGCCGTCGCACTCTCTCGTAGTACACCCACATGTTTGTGGGCGCTC
CATGGCGTTCATCAGATAGCCATCTGATGAACAAGTGACAGGCATATGGACTGTTCGTCGATGCCAGTTGACTTATGGCTCGTACCTTCTGAGTTACGGC
AGTCCAAGAATGACATCGAATTTGTCATCCAAGTCTAATATGATGAATTCATCATTGTATTGGACTCCCTTCAGTGTATAGATAATACCCACTACACGTT
TCATCACCGTTACGGATGCGCCTGTCGCGAGGCACACTGTCCTCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTCTTTTGTCTAGCGATTGGCG
TCGTACAAAGTTTTCGACGCCCCACAATCGACTAGAGCTCGAAGCGACATGCCTTGTGTCACTTCGAGTTTCAAGGTAATGAGGGAAACCTCATTACCAG
AAGCAGCAACACATAATGACTGAGCGTTGGGAGCAACTTTCGTCAAGAGGCCTACAAAGTCACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTGC
TGACCCTGACCGTTTTTTGGCTGTCCGTTACATTGTTGCGTTTTCACAACAACGTTGGACCCACGCCTTGGACCTCCCTTGGCCGCTTGGCGGTTACTGT
TCCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGCATTCATATGCGTAATGCCCTGTCTTCTGACATCTGTTGCATTTCTGCAATTTCTTACAGTTGTT
AACACGAAAGATCTCGCTGCTCGTGTTACAGTAGTCCATTAGTTCTGGGCATCCATTTTCCTGTCGTCTCAACGGACGATAGGAATTCGAATTCGCGTGA
GCCTGTTTCACGCTGAAGTTTTCCTGTTCCGCAACCCTTATTGCCTCTTCTAGGGTGTTGAACTCTAATCGTAACAGGTAGGTTTTAACGGGACCATCAG
TCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGAGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTAC
CTTGCTTTATTCTCAGGAGTTTAGAGCGAGCCCTGAACTCCGCTCGAGGCGGCTCAAAAGTCTGCCTTAGCAGGGACTTGAAGACTTCCAACGACCCAAA
GGCATATGGGTCGTGTAACTTAAGACCCAGGGCCCACGTCTTTGCACGCACTGCCAAGTTCGACTGAGCGAATGCGATCTGCATTTGCTCATCGAGGATA
TGACAAGCCTGTATGGCATCGTCTAGTTCCACGAACCATCTCAATAGAGAGTCTTCATCGGCTCCCTTGTA