Description :
From Genome Similarity Track
Location :
Scaffold_2:203007- 212377
Transcript NameFunction/comments
Phyta_totarag175hypothetical protein PHYSODRAFT_315997
Phyta_totarag176hypothetical protein PHYSODRAFT_334040
Phyta_totarag177hypothetical protein PHYSODRAFT_315999
Phyta_totarag178hypothetical protein

Sequence
9370 bases(100 bases per row)
CGACCCGTTGACTACTTCTTTCGACGCCCCGTTCTAGCGGTTGCGTGCGGTCAACATTACACAGTCGCATCTCTCAGTATGTGCTGTATTGCAAAATTTG
GGCTGCTTCAGAGGAGCTgacatttttttttacgcTCTTGACTCAGGGGATGGAGGTGTCGTAGCGTTTGGGAAAAACGACCATGGACAGCTTGGGCTTG
ACAGCACATCCGAACCGGTATTGCTGCCTACACGTCTAGCCCCTCCACTGGATAGAGCAGTGGTGCCCCAACTTTCGTGTGGGTACCACCACACCGCCAT
TGTTACGGAGGATGGAGCTGTGTACACTTTCGGGCGCAACGACTACGGccagcttggtcttggccaCAAACTTCACATGGCGCGACCAACGGTATATCGG
AGTTTAACGATTTTTTTCGCTTGTGAATCCTTGTGTACTCACTGTTGTGGTTGACGATGATATTAATGTTTTTGACTCTGTAGGCTGTGGAAAGCTTGTC
GCGTATGAGGATCACCCAGGTTGCGTGCGGTTGCTACCATACTCTTGCACTTTCGGATGACGGCAAAGTGTTCCCATTTGGCCGTAATAACCACGGTCAG
CTTGGATTAGAGACATCTATGGACTGCTTAAGCCCCCAACTCATCTCAGCTCTACGGAACAAAACAGTTATCAAGGTAATGAATTATCCATAGATAGAGA
GCAGTCCTACTTGGGAAGATACAAACTCAAGTTTGTTATGTATACGATCACTGGGGCAAATAGATTGCAGCTGGGTTTTACCACTCGGTCTGTCTGGTTG
GGACATCCGAAGGCGAGACTCCAACGACTAAAGGAACTGGGACATTGAACGCAGATTTGCGTAAGATGCTCAACAATTCAACTCGAAGTGATGTCACCTT
CCTGGTAGAGGGTCGTCCAGTCTTCGCACATAGCTGCATCTTGGTAGCCCGTTGCGAGCCACTCGAGAAAATGCTGGACGGACGAATGAAGGACGTGTCG
CAACCGGAAATCGTCATCCCGGAGTATTCGGTGGGTGAAAATGTTGTGCGAACCAGCTTTGACGTATCTCGATCACTGATTGTCACCGTGATCTTTTGGT
ACAGTACGACGTTTTCACAGCTCTAATGGAATTTCTTTACACTGACCAAGTGGTTGCCCTAGCATCACCGAATCTGACGGCCGGTACGACGTCTCCATAT
TCAGCTGGACATGAGTAGTAGAATGTtcctcgttgttgttgtccgCTGCCTACTTACTCTTTGTGTATTGGTCTGAATACCAAGTAGATTTCGctctcga
gctgcacgctcTAGCTGACCAATACCTGGTCACCAGTCTTCGAAGGTACAGCTTGCAATAACTATGGTGGTGATGTGAATTTGTGAATGAGGTGAATATC
TGCAAAAAGTGACGACTAACGTAATTGTATTTTGCTCTTTCCTGTATTCTCATTTTTCGGCAGTTCGTGTGAGAACGCATTGCTACAAATTCTATCAGTG
GAGAATGTTGTCATCATCATGGAGGTGCGTTCGGCATCTTGGTGTCATGTGTCCTCTGCGATGCACGCTCATCTTTTCTGTTTTGATCCATTACCCGATG
CAGTCAGCGCACTTCCGTAATGCGTACACACTCAAAAAGCGTTGTTCAAGCTTCATCATGGACCACTTCGCCCGCGTTATTGCAACCCAGGTATGCTTAT
TTGCCATCGCAATCTTTGATATCCGAATGTTCCTTAATGAATGTGCCGTGTGCATCTATGACTACCGTAGGCTTTTGTCGGACTACCGCAAGAATTGCTC
CAAgaggtgctgctactggcTTCTCACCAAGGTGTATCAATTCCCAATCAGGCAAACGCTGGTGATGGAGCTTGTAGAGAGTATCTCCGCGATCGCTAGA
AACTTCGAACTGCAACATGTTTCACGACAATATGGTCTGTACTGCAAAAGGTGGTGAACTTTAAAAAACAACCATGCCGTCGTAGGTGATCAAAGTATCC
TGTGCAAATAAAACTCCACTAAGTCTTGCTGGAATAAGTGCGCGGCCCCGTCTATTCATCGGTCAACTCATTTCTGTCAGCATGCTTACTGGTGTCTCTA
AGTATCCCTTCCACTGGTTCGAGAAGCGTGCCATTGTCGCTCCGTCAATCACACGATGATCGCCACTCCAAGACACATTCATCAAACGCATGGGCTCGAC
GTTACCCTCTGCATCGTATCGGGGAAGCTTCTGGATCTGGCCAATAGCTCCGATAGCCACCTGAGGAATCATAATGACGGGGTTCATGTATGTGCCGCCA
ATACTGCCGATGTTGGAAATCCTGCACGAAACACGCGACACTGTAGGTAAGAATATGCCCACAAGAAAATTGAAGATAAAAACAAGGCATAAATACGTAC
GAGAACGTGCCCCCGCTCAGATCACTAGGCGCAAGCTTGCCTGCGACAGCCAGTTGCTGTAGACGGTTAAGGTCTTCAGCAATCTCCATGACGCTCTTCG
CCTAATAGAGCAGTACGAAATGAGGGGTAAAGTTAGCGCACAAGAACAGCACAACGAAACATTGAGGAAGAAAACATACCTGGACGTTCTTGACGTTTGG
TACAATCAGACCCGTCGGCGTGTCCATAGCCACCGAAATGTTGTGTGCGGCGATCAGCGTGAGCTCCGACTCGCTTTCGTTCACGGTCGCGTTCAGCATA
GGGTAGTGCTTCAAAGCCAACGACGCAGCCTTGATGATGAAAGGCATAAACGAAAGCTTCACACCACGGGACTCGGTAAGCGGCTTCAACTCGTTCCGGA
GTTCGTACAGTGCGTCCATCCGAATCTATTAAGACAAATTaacaagcagcacaacaaGATCAACAACGTGCACCACTATAGGTTCATCTCCCACGCTCTA
CAGACACATTACATACCTCATCGGCATATCCAAAGTGGGGGATCAGCAACGCCGCGTTCATCGACTTGGTCATCATCTTCTGAATCgctgtaccggtatt
caAAAACAACAAACCATTAATCAGGACGAGTTCCAGAATGATAATAGCCTAATTGAACAGCAGAAAACTCAAAAAGAGACACTTACGTGTCAGCGGCACC
ATCGTGTCTTGTTGCAAGTATGTCACATTGGGTCCGTCCTCTGCAAGAGgttgcacagcagcaacaataaGGCCTGTAGGTGCAGCAAGTCTTGGGGGCT
CTGCTGCAAGCAGCCTGATGTACTCCAGCAGATCTCCCTTCAGAATACGACCTTGCGGTCCCGTGCCTTCCACGGCGTGCAAGTCAATGCTGTGCTCCAT
CGCCAGCCGCCGCACCGATGgcgacgtcagcagcttctcgtcggctGCACGTCTCCGAGGAGCAATATAAATCCTCGATGGGACAAGCGTGGGGGGCTCC
ACCGGCGtaggagcagcagccacaggagcaggagcagccaCCGGCTCCTTGGTGACTGGAGTGGACGCCTTACGGGGGATCGGAGCTCCCggcgacgcct
tcttcttgccacctCCTTGCTTGGCCGCAGCTGTGgcttcgtccacgtcgatgtcgatgaGCGTGGAGCCCACCTTGGCCATGTTGCCCACCTCGTAGTG
GACCTTGGTGACGACTCCGTCGTAGCGACTGGTGATCTCCACCGTAGCCTTGTCGCTCTGCACCTCGCACACGTTCTGGAACTGCTTGACCTCGTCGCCG
CTCTTGACGAACCATTGCAGTACTTCCACCTCGGCGATGCCTTCGCCGATGTCGGCCAGCTTGAACGGGATCTCGGGGAACACAGTCACGGCACCGGCGT
GGAAGGCGCGACGATTGGCGGCCAGTCGCTGGCCCAGACGACGCACGTGCAACAACGAGGAACTCatgagtgagtgagtgctTACTAGGACTCCAATTGA
GAAATGACACCAAAGTTGCAGTGCTTTGAATTGTGGCCTGTCTGGGCGTGACGTCGTCGGAGGTTAGGGCAGTCTGATTCTGGCGGAGGAAAAGGAGGCG
AGGCGACGTGGGGGACTAAAGTACATGTTGGAGCGCCGAAGAACCGACAGCGTCATCTTCGAGCTGTACATGCACTAGCAGCGTACCAGCAACGCAAGCg
ctcctgcatctgcaacTCAGACTGTCTCCGAGACTAAGTGCTCTCTAAGCCTCTCATTTCCTTATTTCCCCGCTCGCGTGAAGCCCTTAATAAGTCCGAC
CTCCTGATGACACGCCCGGTTCAAGACGGTGCGCTCTTCCTGGGCTTGGACTGCTCCACGCAGAGCATGTCGGCCGTGGTCGTGGACACTCGCGGCCAGG
TGGTGTACGAGAGCTGCTTCCGCTTCGACGATCGTTTCCCGCGGTATGGTACGGACAACGGCGTGCTGCGTCCGACGGAGAACGAGGTGGTCATCCCCTC
GCTCATGTTCGTCGAGTCCCTGGACGCCATCTTGGACGACTTGACCAAGAGCCCGGTCGATGTGGCCAAGATTAAGAGCATCAGCGGCAGTGCACAGCAG
CATGCGTCTGTGTACTGGAGCAAGAACTTCTCGCTGCGTGTCTGCTTGGACGCTGCCGCAGAGTCCGGTGCCACTTCGATGGTGGAGGCCATgaagaaac
agcaacagcctgCCTTCTGCTTGCCCAACGGGCCCAGCTGGATGgacagctccacgacgcgCTACTGCACAAAGTTGGAGgctgctgtcggtggagCTGA
CCGCGTCGCTGAGATCAGCGGATCCCGAGCGTACGAGCGCTTCACTGGCAACCAAATCACCAAACGGATTCACGAGGACCCAGCATTCCTGGAAAAGTGC
GGGCGTATTGCACTGGTTtcgtcgatgctgacgtcgttgctgtgcGGCGACTACACTCCTATCGATGACAGTGACGGATCTGGCATGAACCTCCTCAACG
TGCGAGATCGGGTGTGGTCCCCTGAACTCATGAAGGCCACTGTCAAGTACAGCAACTCGGTTAATGCCTCGGAGAAGTTGGAGGCGGCGTTGGGCTCGCA
GGTTTCGCGAGCGTACTCGCCGGTGGGTATTATTCACGCCTACTTCCAGAAGAAGTACggctttgctgctgattgcAAGGTGATCCCGTTCTCCGGTGAC
AATCCGTGCACGCTCGCGGGCATTGGTCTCTCTCAGCCCGGTGACGTGGGTGTGTCTCTGGGCACATCCAGCACGCTGTTTGCGGTGGTGCCAACGGAGG
CTGCGCGCTTCTCCGGTAAAGAAGGACACTTCTTCTGCAACCCTATCGACCCCAACACAGTCATGGCCATGATCTGCTTCAAGAACGGCTCGCTCACACG
CCAAGAAGTCCGAGACCGTCGCGCGGGTGCGTCGTGGGAGAAGTTCGAGGAGCTGATGCACGCCACGAAGGCTGGCAACGGAGGCAGCACGGCGTTTTAC
TACCAGGACCCGGAAATCACTCCGTCCACTCTCAAGGCTGGTGTTGTCAGCTTCGACGCCAGCGGTGCTCGCACTGACATTACCCTCTCGCCACCCGAAG
TCGAAGTGCGTGCAGTGGTGGAAAGCCAATTCGTgtcgctgcgtctgcacGCAGAGCTGCTGGGTGTGAACAAGCCACAACGACTTATCGTGGTCGGCGG
TGCCTCGGCGAACCAGTGTATGCTGCAAGTGCTCGCGAATGTCTTCAACGCGCTAGTGTATCGCCTCACCTGCGCCTCCAACTCGGCAGCTCTGGGTGGT
GCGTTCCGTGCCCGCCACGGATTTGCATGTACTGTCAGCGCGTCCGGATACGTGCCGTTCGATGTGAACGACAGCCTCGACTTCTCGCTGTGCGCCACGC
CCATCGAAGAGGATGCCAAGACGTACACGAGTGAGATCCCCCGCTTCGAATCCCTGGAGAACCAAGCTGTCAGTCTGCTCAGCTAAGGTTGCAGCTACCT
CCAACTTCTACTGTCTGTTGCTCCCGTCCGGTCGAGCCATGGTCTGCTTAGCGAACTCTTCTCTTTTTCACCTCACGTTCATGTACAGTGTAACAAAGGC
AATtgatgctacatgtactgttcTGGAATTGACGACCACGAGTGGGGGAGGTCATCCCTCCCGGCGAAAAACACCTGAGACCGTGACGTCGCCCAAATCC
CTGTCAAACAGCATTGAAGTTGGCTACATagacgttgaagcagctgtTTTCCTCCAATCATTTCGCGTTATCTTTTCAACCAATCGCAATCGGAATACTC
CAGAAAGTGCGTTATCTTGACTTTACTAAgaaaatggctacatttcaATTATTCCGTACATCATCAAAACAATTTCCGTGATGCATACGAAAGGTCATAG
ACCAGTTCACCTGCTGCGTCACTCAAattcaagctcaagctcaagctcaagttcgCCACGCAGTCCCTGAATAGCTTCGCACTGTCAAAAGCCATCGCAA
ATGTCCTTACTGCCATCATCCCGCAGCGTCTTAACGCGACGTCTTCGCCGTTCGCCTCTGCTACGAGCTCTGCACGTCGCCCCTCCGCTcgcgcaagcgc
aagaggaagaagatgacgctCTACCGGTTCTCGAAACGACGCAGATGAACATGTTCACGGCTATCAACGACGCTATGCGCGTAGCAATGGAGACGGACCC
CACCGCCGTGCTCTTCGGCGAGGACGTGGCCTTCGGTGGCGTGTTCCGCTGCTCTGTGAATCTCCGCGAGAAGTTCGGCAGCGACCGTGTCTTCAACTCG
CCGTTGTGTGAGCAGGCCATCGCGGGTTTCGCCATCGGCTACACGTCCACAGGACGCACGGCAATTGCCGAGATTCAATTCGCCGACTACATCTTCCCGG
CCTTCGACCAGATCGTGAACGAAGCGGCCAAGTTCCGCTACCGGTCGGGCAATGAGTTCGACTGCGGCAAACTCACCTTCCGTGCACCGTACGGAGCTGT
GGGCCATGGTGGCCACTATCACTCGCAGTCGCCCGAGGCGTACTTCGCACATACACCCGGGCTCAAGGTGGTCGTGCCACGCAACCCAGTGGCAGCAAAG
GgattgctgctggcatctATTCGGGACCCGAACCCGGTACTTTTCTTGGAGCCAAAGGCGCTGTATCGGGCATCAGTCGCAGAGGTGAGAGGCGGCTGGC
TTGTATATCTGTGGTGTGAGGCGAGGTTGGAGGTGAATTGCTGACAATTGTTCGTGTGCTGATGTACGGTAGGTGCCGGTGGGAGAGTATGTGCAGAACC
TGAGTGAGGCCGAGATCGTGCGGCAAGGCACTGATGTCACCGTTGTCGGCTGGGGTGCCCAGATGCGAGTTCTTGAGGAGGCCTGCGGGTACGCTGAGGA
CATCGGCATCAGCTGCGAACTCATTGACTTGCAGACGATCTTCCCTTGGGACGCTGACGCTATTGAACATTCGGTTCGCAAGACCGGTCGGCTAGTTATC
AGCCACGAAGCTCCGGTAAGATTTTGCTGGATGCGCTACTGGTTTCTGCGAGTTGAGGCTTATGATAATGCTTTATGCAGAAATCTGGTGGGTTCGCCGG
AGAAATATCGTCTAGTATTCAAGAGCGATGCTTTTTGAGCTTGGAGGCCCCCATTCAGCGAGTGTGCGGTTACGACACTCCCTTCCCGTTAGCGTATGAA
TCGGTGAGTTTGCACGAGACAGTTTATCGCCTTGAAAATAATTTTCGCTAACGCCTTGCAATGTCTGTCAGCACTATCTTCCGGACGCGCTGCGGAACTT
TGAGTCGATCAAGAAAGTAGTGGATTACTAGCTTTTGAAGCTAGCCATCCACCCTCGCCAATGATTAACGATCATCTCGATCATTTTACACTACGTTTCC
AACATTTTTTTATCGGAAATTTGGCGAGCTGTTCTCTTCTTGGTTACTTTTGCGCTTTCTGTGCCTCGGGTTGTAATAAGCTTTCGTAATACTGGCAGAA
TAACTGCGTTTGTGTGAACTCGTCCAAGTAATCCTCGTAAATGCTGTTGCGCACTTCCTTGGCCACCTCTTCCTGTAAGCGGTCGTAAAAACTCTGACCC
CCTGGATGTGATAATGCATGTACGGTCAGCCATGAATAAAGCACGTCATAAAGTATTCTCGGATGGATTGCCTACCTGAGATCGAAGCTGCCAGGTCTTG
AGAAGAAATGTCGAAGCCAAGATCACGCAAAAAAATCTCCGCTTCCTGCAGTGTCAGTGTGATGATCGTGTCTTGCTCGTCGGAAAGTTCGTACCACGGC
TTCCCTGACGGGCGCAGTGAGCAAAAGCGCTCTTTAGCTTTCCGAAGCAAGCGGCAAAGCTCCACGCCGTTGGGGATTGATGATGGACCCAAGTGCCTCG
TCACAGCCGGCACAGCAATACGGTCCTTGTCAATATCGTAAAAGCAAACATCTGACCACTCGGATGTTTCACTCAGCGAGTGGCAGCCCACGAGGAACGG
GACGGGCGAATGCAAAAAGTCCAGTAATCCTGAGGGTAACAGGGGGATGTACGTCGACTGCCACTGGAAGGGAGTGAGCAATAGCAGAAGCGCCGTACAT
ACGGCTGATACCTTGGCGGGGCTGTCACTCATGATCACCACCTGCTTCTCAAGCAACAAGTAGGCCATAATCTCGACCACTTTGTCTGGTGTCAAAAATC
GTAACACAACACCAACTGACCATCGATCGGAGTGGCGTTTTGGAAACTGGTAGCTGAAATCGAACGTCGGAAATCGAGCCGTAGACCAGTGCCCTGGGTC
GCTTATCTTAATCCGTCGTGCTCGGTGTAAGATCTGTAAAGTTCAACGGCAGCATATAGGGTCAGTATAGTACTCCTTTGCCTATGATACCTACAATTAA
CCTACATCgacagaagaagctgataAGCACCGACGATGCTGTGGCAGCTTAGTAGTTGCTGGGGATGCTTGTGCTGTCGAGCTTGGCCTGCGGAAGCGCA
GACGCATCGGCCGATTTCCCTTTTCCAGCAATGTCAGCGTTTGTTCAAAACTCATGGACGCTACAATTCAAAGACAAACAAACAAACTCTCGTCATGAGA
AAGGGGTGCTGATCAGGAAAAATGAATAGTTTGTTGTACCGGTTGCAATGCTGTCAACTGCCTCCAGAATGTCACCAATATTCACGCGCTCGTATTCTTT
TGGTTGGCTCGAGTCGATGTTCTTAACCATCGGTTTATCCATAATCCACTCATTGGCAACATTGTAGGAGCCAATATCGTCGGTGCTAAGGCTTTTCCGT
AGTTGGCTCGGTCGCCTTCTTGTTTCAGTTTTCGGTTGGCTATCATTTTTGTTAGCGCTTACACTTGCATCTTCGCTCAGAACAACACGCCGTTCCACCG
GAGAAATGCACAGCTTTGTCGCAATTGAAGTCAAATTGTTCTGTTCGCTCGCTTCCGAATCACTGGGCTG