Description :
From Genome Similarity Track
Location :
Scaffold_1518:2030- 3956
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1518-snap-gene-0.1Proton-dependent Oligopeptide Transporter (POT) Family
Pytul_var.sporangiiferummaker-pug3_contig_1518-snap-gene-0.2Proton-dependent Oligopeptide Transporter (POT) Family

Sequence
1926 bases(100 bases per row)
TCATTTCCAAATTGTCCCTCAACCGCAAACATGGGAAAGCAAGCCTCGCCTTCGCCAGTGGTCACGCCAGGGGCGCTCACACCCACCATCACCACGAACT
ATAGCACCAAGCTCTGGGACGAACGTCCGCTCAAGTACTCGCAGCATGTGTTCCGCAACGTGTGTCTGTCGCTGTTCGTCATCACGGCGTTTGAAGAAGT
GGCGAGTTTTGCGCTCGGCCAATCGCTCAAAAACTTTTTCCAAAAGTTGGGTTGGTCCAACAAGGGATCGACATCCATGAAGCTCACGTACGACTCGCTA
AGTCAGTTCGCCTGTATCGTTGCCGGGTACCTTTCGGACGAGCGCTTCGGCAAGTTCAACACGCTACTGGGGGCCGCCACGCTCGACTCGATCGGTTTCG
TGTTGCTTGTGATCGCGTCGCTGCCGTCGGTACTCAAGCACATCCACCTCAGTAAAACACTCTTCTGCATCGGTCTATTCTTGGCGGTGGCGCTGTCCCA
GATCTGCCTTCGTTCGATCGTGATCTCGTACGGTGGCGACCAGTTCTCGCCTNNNNNNNNNNCGCGGACCCCAAGCAGAAGGCGCTCTTCTTCAGTGTCC
ACTATTGGGTGGCGAACATCGGCGCCTTCATCGGCTATGCCGTGTTCCCGTCCGTGTCGATNNNNNNNNNNNNNNNNNNNNNNNNNACGGGTTCGGCGCA
ATCCCTGCCGAGTACGGGTACTTTTCCGTGTACGTCGTGGGTCTCGTGTCGCTAGTGATCTTCGCCGTGGTGCTGTTCTTCACGCGCAGACGCTACGTGA
ACGTACCGGCCGAGAAGACCTCGATCGGGTTCGTGATCAAGGTGGTACTGAACCGCGCCAAGACCAACTTCCACGCCAAGATGGTCGTGCTCGGGATGAC
GCTGTACATCCTGGCGTTCCTACTCAACATTCTGGCGTCGTTCTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTGCGGCGTGTTGATCGCGATCGCGACGATCCTGTGGGTGTACTTCGGCCGTGACTCGAAGTTCATGGAGGGTTCCAAGAGCA
CCCAGGGCGGAATGTTCGACGATGAGCTCATTGACGGTGTGAAACAGGTGATCCGCATCCTGCCGTTCAACGCATTCAACGTGTTCTGGTGGGTGTGCCA
GAACCAGCGCGGCAATAACCAATCGATCATTCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTAACCCGATCGGCGTGCTCCTGTTTGTGCCGCTCGTGCAGAAGGTGATTTACCCATTGTACGAGAAGTACGCGGGCAAGCCTCCGAGCC
GATACGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATCGCGATGTTCTGGACGGGCATATACGAGATCATCCGCCGCAACGCCGGGCCGATCACG
TATGTTGGCGCGGACGGTGCAATGCACTTCATCTACAACGACGACGGCAAGCAGGTGATGAACGACATCCCGTGGTGGACGGCGCTACCTCAGTACCTTN
NNNNNNNNNCGGTGTGATGATCGTTATCCCTTCGTACGACGTCTGCTACTCGGAAGTGCCTCAGGTCATGCGCAGCACGTCAATCGCGCTCGGATTCTTC
GTCAACTCGATGGGCAGCACGCTGCTGTCGGTAATCGTGCNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCGGACAGTACATCACGCCGAACCTGAACAAC
GGCCACATCGAGTACATGTTTTTCACGATCGGTGGCGTCATGATCGTCAACATTTTCTTCTACGTGCTGGTGATGAACCAAATGCAGCTCGGCATGATCC
CTCGTGTGAACAAGGGCGAGAAAGAG