Description :
From Genome Similarity Track
Location :
Scaffold_1295:2030- 3035
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1295-snap-gene-0.2Gene of unknown function

Sequence
1005 bases(100 bases per row)
GCACTGGCAGATGGTTAAGCAGCGCTGCGCACGGTGACTCCTGCGTGATCAAAGCCAGCGCGAGCACCAGCAGCGGGCAAGTTGTGAAGTCAGCGTCAGG
GAAGAGCGACAGCGCCTGTTCGTTGGATGTTTTCACGCGGATGAAGCGGATGAAGAACACGCCACCAGCACCGATGGAGAGCTGCTGCTTCCGAACGAAA
GTCAAGTCCGAAGAGGTACCACAAGAGGCACAGCAGTGCAGCATCTTGGTAGTCCTCCGTGCAGCTGGCCGTTGAATAGAGATACCTTGTCATCTTCTTG
AGATCCTCCTTTGTGCACGCAACTGCCTTCGTGACAAACCCACCATTTTCGCGCTTGATGCAGTGCTGCTCGAGCGTTCGCCCCATGCTCAGCTGCCGTG
ACACAGCGCTGCCTTGAACAGGATACTCGCCCAGAAGCCAGCACTTCACCTGGCGGAAGTGTTGAGCGACAGAGTGGCGGGACAGGTGCTGTTCCCGTGC
TCCTGCGTGGAATGCCAGGTACACACCAAACTTGTCCATCAGCGTCACTAGAATTCCGCCTGCGCGACTTGGGTCCACGAAGATCAGAGCTCTGACATGC
TTAATGCTTGTGCTTTCAGCGGAGAGGAAGCGCTCGAACGCCTTCATGGCCGTCGCTCGCGCGCGCTTGGTGTTGGTGGGCTTTAAGTCGTTCAGGCTCA
TTGTTCTTGGTCGGAGAGGCGGCAAATATGCGAGTGATACGTGGCACGCAACCAGCTTGTATGTCGATACAAATATCTGGGAGTTAGCTCCGACCAGATA
CGTCGGAATCGCACAACATCCGACTGTAACCTCTACCCGCGTTGTGATTGGATGAAACTAAATAATGTGAAGCGGTACTATTCATCAAAAAATTACAAGA
TGTTTTTTACTGGCCAAAAACAATCAATGAAGCATCTCATTGGCTAATATGCATAATACGATGATCAAGTTCAGTCGGAGAGCTGATGTTATTCATCCAT
ACCAT