Description :
From Genome Similarity Track
Location :
Scaffold_505:203- 7475
Transcript NameFunction/comments
g7657.t1RAW28531.1 hypothetical protein PC110_g15085 [Phytophthora cactorum
g7658.t1ETO84177.1 hypothetical protein F444_01881 [Phytophthora parasitica P1976

Sequence
7272 bases(100 bases per row)
GGAGCAATCACAGCACAAGTTGACACCTTCAGTGCCGAAACCAACGAGGCTGCCACCAAGACCAAGCGGACTCAAAGCGCGGTCTCCGACGACACCCCAG
CCCGATGAAATGAAGACGTTGGCGGTGACTTCATCGTCAAACAGCCTCAAGCTGGTGCATGCGCCAATCTTGTCGGATGACGAGTCCGACGGCGAGTTGT
CGATTGCAGATACTGGCAGGGCAGATGTTCAGGAGACGAAGTTCGACCCGGAGGCCTCCCTTACGCTTCCTTCAAATGTGAGTGTTTGTAACTCCTGCTA
GCGTTACGTATCCAACCTGACTTAGTATTTCTTAGGATGAGCTTTTACAATCCTACGGCGGAATCGACCGCTGCATCCAAGAGTTACTTGGTCAAGCAGA
TTCGTCGGACTTCATTGGTCGTGTAGGCCATCTGCGCGAGCTGGTAGACAACTTCGCTGGTCTGAGCTCGTTCCTGCAAGCTGGCAGCAAACAGCGATCG
ATGAGAGACCCAGAAGTTGTGGCAGCCGACAAGCTCCGACTCAAACTCTTTGATACTCTTTCTAGCGTGGTGCTTGAAAAGTGGGCTACGAACGCAGCTT
CCGTACTGGAACTGGTACCCGCGCTTTTCGATTTGTACGGAGCTACTGGCAATGATCGTGGAAACATGAACGCCCAGATCATCAAACTCGGAAAGACCCT
GTTTGTTCTCAGCAAGGCTAGTGACAACGATAGCTGCTTCTGCAACGTGCGCTACGTCGAGGCCATCCTCCACGCAATTGCTGCGACTAGTAACCAAGCC
TCTGGTCACCACGATGAAAAGCACGCGAAGGACAATGACACTACAATATTGCTCTCTGCAGAGCAGCAGAGCATCCCTATGAAGGTGCTGATTTACACGG
CGGGAACTCTGAAAAACATTTCGAATGCAGACGACAAGATGGCCCGCCTGCTGGCTTCAAACCGTACAATTGCAATTCTCAGCGAGACAATGCTGTGGCG
TGCTGAAAGTGCAGCGAGAAGCAAGGAAATCGCGCAATTCCTGATCCAAACCACTGGCATTTTGCGCAACTTATCGATCTCGAAAGGCAACCACAAGCAG
TTTCTTGAAGCCCACATCCCTCTGCGGTTATGCGGCATAATCCCTGCGTTTATCGCCCACCAAGAGCTTATGGTGAATATCTCGCGCATCCTGAGCAAAC
TCACGCTGCACGAACTACCGCGGGCCCAGATCAACCAGGGCTCCACCTGCATGAAAAGTCTGATGACTCTCATTGATCACCGCCAAAATTCGTGGCTTTC
ACTTGTGGATCAACAGCGGTCCGACATGCGCTTCCAAGACTTACTCTTCATCCGAGTCTTTTTCGTATTGGGGAATTTATGTGCCGGCAATGACCTGAAT
CGGCGCTTGGTAGCTACGAACTTCTCAGGTATCACATTGTTGCTGGACGTCCTACAGTTTTATGGTGCTCGCTATACAGACGCTCGAAACAACACGGAGA
TCAGCGATAATGACGAACGGCGTCGTGTTTCTGACGCCGAACAGTCAATGGAGGTCTTGATCAAGCTCGTTCGAGTGATCGCCAACCTAGCCATCAACGC
TGATGTGGGTGCTCAGCTCAATGAGAACGAAGGCGTGGCGCCGCTGCTGGAAATTCTGGAAGTCGCTCAGCAGGCGGGAGACGAAGAGCTCATGCTGAAC
ACCGTGAGCTGCATCACAAACGTCTCGTACTATAGCACTGCGCCGAAAGGTGAGGGCAAAGCTTCATTCCAAAGTAGCGACTACTGCTTCATCGAAAGCA
ACCGCGTTGCCATCACCCAGCTTCTCGCGCGGATCCTCCTTGACAGAAACGAAGAAGCTGTAGTTGAAGCGGCTAGAGCTTTCGGAAACCTGTCGCGATT
CAAAGACGTGCTAGTATACATGAGGGAGCTGAAAGTACTGGACTGTCTTGTCGTCCTGCTAGACCACAGCAATCGCGAGGTCGTGTACACAGTTTGTGGC
GTCTTGATGAACGCTGCCCTTGATCAAAGCACACGTCAAGCATTGCTATCAGCTCGCCCTGCTGTTGACGACGATGCAGTCGATGCCCGCACGCTGCTGG
TCGGGATAGTCGAGTGTGCCGCTGGAGATGACTTGGAGATGACACTAGTCGCCAGTAAAGCACTATACAACCTGCTGCTGTCCACGGACATTTTGTCGCC
ATGTAGTGACAGCGCGGCCGATTTTACAGCTGATGCGAGGAACCTACGCCGAACTATCGAACAAGTACTGGGTACGATCAGCGCCGAGGGAGGAATCAGC
AAAGAGTCAGGCGAACCAAACGAAGACGACGAAGACGACGAAGACGAAGAGATATCCGATTCATGGAGCAATCGGCAAGAGCTTCGGCTAGTGCTTCCAC
AGCTGCTTCGAAGTGTCAATTCGCTCATTAACCCGATGTAGTACATGTACGCCTAATGAATTGGTATTGAACACCTGAAAGAGGCTTCTATCTCCGTTTT
TCCGTTTTACACACGCTGAGAAACAAAAACAAATATGTCGGCAGGTACTAAATTATCCAAACTTGGCTATCTATTGTTGGGCAACAGAGATGACAGCTGC
GAAAGCCAACGTGATAAGCATTCATACATACTGTGGACAAATTTGCTCGATGAAGGTTCAGCCAGCTGCACATCATGGCCCAGGGCAGGAGATTAACACG
AATATGTTTGCTGCAGCATACCACAAGGCGGCGAATCTCTGGCATCGTAGTCATATTGGACACCGAAGTGAGTACTCGGTCGAGCGGCTACTTGCTTTCA
GAGATTACTGTCAGCGAACTTCAATGACACGTGTCGTCGCTGTTTGCATCCTGACGCCGATTCCTGCCATCGTGGTGGCGCTTTTGATCGATTGCACCCC
ACTAAAGCCTCCGTCCGATGGTTGGCAGGCGAACTATGCATTCTGGATTCGATGGTTCCTTGCCCTCGTTGCTGTGTCAGTAGGTGTCACTGCACAAGTC
CGAGAAGTGATTTTGCCTGGAATCATTACGAATGCTGGAGCTATAGCCATCGCTGTGGGGACTTCTGTCACCGACCTATCGATAGCGATCACTATTGCAG
CGCTGTGGCGCTTTCCAATACCGTTTGGGTATATAGTTCTTGTCGGCCCATATTTGGTCATCGTCTCTAGCTTCACGCTGCTGGTTATTGGGCCACGTCT
GCTTGCTGAGTCGCCAAGTCTTCGTCAGCAGCTTAAGTCGCAAGTTACGATTATATTTGCTCAGGGACTTGTGGCAATGGTGTACCCGTTCTTGACCGCA
GCCTTTTACCAACTTTCAGGCCTCCAGCAAACTGCCTTCGTGATTGTGATGCCCATTTTTAAGCATTTCACGAAACATGTTATCGCAAACGCCGCTGAAG
GTCTTCATGAATACGTCGGACCGATTGTGGTTTTCTCCGTGGATGTCTTCAACGTCTTCTATGTTTCAATCTGTATGCAGATATCCAAATCAACACTCAC
GACGCTGCTAATCATTGCCTCGGACAGCTTCCACGTAATTGTTGCTCTTCGCGACATTTTCCATCAAGCCAGCCTCGTAAAAGCAAATGAAGGACAAGGA
TCATCAACCGCAGTGAACTACATCGAAGAATTACCAGGATTGGTTCGCAGACTATTTGAAGACCCAGAAATATCGTCACGTGGCTGCAATGTTCGAGTAC
ACGCTCCGTTCCCTCTGCCACTCTCAGACGAAAGCATTCTGTTCATAAACGGAATCTCAAAAAGCGGACACAACACTCGAGCTTATTCCTCGTCGCGCAT
ACAGACACTAGGCCCGACAATCCACCAGCTGACCGAAGCCAAACCGAACCAGGTGAGCTATCAAGGACCTCCGACTAATCCAATCTCAACACTTCACCCT
GGGGCTTCCCGTAATGAAGCAAGGGTACCAAGGAAGGGGCCTACTCCGAGAAGACCTCTAACGCTGATGAGCACAGACACAACTCTTTCAGCTGATAGGC
ATCGGTCTACTTTGTCTCATGCTCCCACAGAGGAAGCCGTTTGGGAAGCACTCCAGGCTCTTTTTCATTCGGAATATCTGCTCATAGCCGAGTATATTGA
GTGCATATTGCCAATTCTGTACGCGATATATCTGCCGGCTTTGTTTTATCTCCCAGTGGCTCCATACTATCCGCAAACAGCGTCATCGAATCCCGAGAAG
CTGCGTCAAGACGTGACCAACATCCTAATGTTTGCAGCGGTCGAGTTCGCAGGCTTCGTTGGTCTCTTGTTACTTCTCCGACAGAAATTTGGAATCTCTC
CGCTGTATCAGCTTGCATTCGTACTGGAGACTCAAATGCGCACCGTCCAAGGTCATTTATTCGTTTGGACTGTTTACATTTTGCATATGCCGCTGATGCA
TTACGGTAAGCGCCAGCACTCTTGTGCCGACCTTTATTGTAAGCACACTGATTATTTTTTTTTATGGCGCAGGTGTAGACTACGACATTAACTTTGGGTA
GGAAAGTACCAGATCTACATAAACTGTCGCTATCACCGCTTTGCGGACTGTAATTCTTCCCGCCGGAGGCTTTATTCCTCCTAAACATCAAGCATCAGGG
TCGATTCCGAAGGTCTCATCACGTCTTTGGGGCAATACGTGTCGAGTTGAATATTATATGGAGTCTCCACAGTCCGAACGTCGACACCGCAGCCATAAGA
AAGCGGATGATCTGGATTCCCCATCGTAGAACTCATACGGTACTGAGCGCGTCGGACATATTACTAGCTACCACTCCACCTTTCAGTAGGGCCCGTGAAA
TCGTTGTAACAAACAGGAGTGATACCAAAAGTTTGAGAAAGGTATCCCCCGGCTACCTCATGGAGGTCGTAGACATTGTAGTTGTCGAAGCTCCAGCCCT
TGAGCCCCAAGCTCCATCAAGTTAATGAAATCCAACTTACTTAAGCGCCAGAAGTCGAAACTCAAGTAACCTGTTCATAGTTTTGTTTCTCAAGAATTCT
GCGCTTCGTCGCTGCTGCGAGAATGGCTCGTTAGCCAGTTAAGCTTTGAAATGCAACAAATATCACGCTGTGTTGAGGTAATTGCAATCAATCCAAGGCA
CTCGCTAACTTCGACGCCCTCCCCGGTGCTCCCACGTTTACTAGACCGACATCTCCGTCTTCTCGTCGCCCGAGCTGCCCAGCAAAGGGGTCGCCTCGTC
CCCTACAGTTTTCGGTGTCTCGTTGTGTTTCGAGGTCCAGATCGTGGCAACCAGTGCAGCCAGCGTCAGCGCCACGAACAAACCAATGACGTTACCAATC
ACGCAGTCCGGGGCCATGTAACCCTTGACGGTCTTGCCGTTCAGCTCGCCATTCACGTTACAACTGCCGTTGAACGCGAGCTTCTCCAGAATGCCCGTCT
CTACCGTCGCGACCACGAGGCCAAGGATCGACATTCCAATGGCGACGTGGTAGGGGGCGATCGACGCTCGAGCATCCTTCTCCGCTCCAGGGTAGAAGAA
TACAACAAAACTCCCCAGCCACTACACACCACCACAACAGAACCAGGAGTCAGCATCCAGTCACGACGAGTATAACACAACAACACGTACGTGCGCTCCG
AACAGGATCAAGACACTCAGTCCCAACCAACTATGGAGACTGTAGAGGTTCGTGATCCCGTGCTCATTGTGGAAGCGAAACACCGCAACGGTACCAGCCA
CCGCACTCAGGAAGCCCAACGCATGGAGTGATAAATGAATTCGCTGCACCAAAGCCACAAGACACCATAAGATCATCAACAACGGTTCCTCCTCTACTTT
TTCCGCTCCTCCCGCACCTTGTTCACTGCGTGGCTAAATGGCAACGAAATGTAGACGAGTGCCGCTTGAATGGAGCAGAACACAAAGCCGAAGCTCATGA
GCAGCGGGTGCCAGTTGAACACCCGCGCGTCCCCGTGGGTCCACGAAAACCCGCCCGTCTCCGTCTCCGTCACCACTCCGTCCTTGACTGGATACGCCGT
GAGTCCGCTGCCCATCCAGTAGCCCACGAGCACAACCACCAGTGCCGGCAGAGTCTGTACAGTACAGTTGCGACCCAGAGTGAGATGTCTCCTTAGTGTT
TTGTCGCAAAATCTCGGCGGTGAACAGCGCAAAAACTGTGCGTTCCACTCGCAACGCTCTCCTGCATTAGGTGAGTATCAATTGTGGCGCTTACGTGGGC
GAGAACGCGCGTGAAGAGCACCATGTTAAGCCAGTGGCGATCGTTCTGGTGGTCTCTCGGCGAAATGTCGAATGAGAGGCGCGTCAATCCGATCTTTCCT
GTGATTGGCCTATTTTCTGGCAGATGGGGGCATTCCATATTCGCAGCAGTACAGTCACCCTCTATAAGTGACGCCCGATCTGTCTGGTTGTTTCATTTAG
AGAATGTGTCAGATTTGGAAATGGCTACATTCACATTGGTGTTAAAAAGGTATCCAGTGATGCCTGCCGCCGCCGCTTCCCTACTTGGTCTCTAGCTACC
ATTGTCAAGGTCTGAATCATTTCCAGTTCCCGCTTTGTATCCCCTCCACACTGGAATAGAAACGAAGAAAGCTCCATACAATAGGTGAGTGCTGTCGATG
CTGGCAAAGGGGGTTTGTCGTTCTCGTCGTCCACGTCACCATCCACCTCTTCAGCATCATCGTCCTCGGCATCGCCTTCTGGGAGCTCGTGAACTTCAAC
GTCAGAATCAATCTCCAAGTAGTGGTCAACACTATCGTGGGCGCTAACCCCCTCCAGCATGCTCACAATATCGTTTACCACACTTTCTTCAGCAGCCAAC
GCATACTCCCCTGCCTGGCGGAGCTCCCCCAACAACGTAGCGTCTACGATCCTTGACTTCACCCAGTAGTTGCGTATGCAATCGGCCGTCACATCGCCCC
AACTATCACTGCTGAACTGGATTGCCTCGAGAAGGTTCAGTTTCCGCTTTATGTCGCCGTCCATTGCGTCAAGGCATCAGCGGACAAATCGACGACGGTA
GCGTGCCTTAAACGATCGGATAATGCCTACAAATATAATATCAATCAGTAAGTTCACTAAGCATTAGCCAAATATGTCAGAAAGCTTACCTGAATAGGCG
TCCATATAGGGAGTTCCCCGACCCTTCGGGGCTGTCAGTTAGAGAATAAGGAGGGTTTTAGTCAGTTAGAGAACTTCTTTAGTGAAAGTCATATGAACTC
TTTTGCACACAGAGACGACAATCAGATAAAGAACGCGTCAGGTAGAGAGGCTCAGTTAGGGAGGTGTGACTG