Description :
From Genome Similarity Track
Location :
Scaffold_1158:203- 3897
Sequence
3694 bases(100 bases per row)
GCAGCCCCCTTGCGACTTAGTCGCACCCGTGGGCGCTCACCCACCAGGCTCCGCCGCCTCCGAGTTCTCGTGCGACTGCATCGCCTCGAACCGGTTGCGT
CCCGTGCGCCGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATCGAGCTCGTCGACTCACGTCGTGTCCGGGTAGCCCTTCCATTTGACTTCGA
ACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCACCCTTCGCGCACGTTCACTATCTTCTCGACCTCGAAGACGTCGTCCTCCAGCTCGCGCGTGACTTC
CCAGCTATCCTCCGGCAAGAGCTCCACGTCGAAGTCGAAGCGCTCCTCGGTCGGCACCGCCAGCTGCGTCGCGGGTCGCGACGGGAATTCCCGGACGGGC
TTCAGCCTGGAGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGCCGTCTCGAGGCGCACTGCGAACGCGCTGACCAGCTCGGCGACGCGGAAGG
GTCCGTGCCACATGTGGGCGAGCTTCGCATACCCCGGCTTCACCCGATCCAGGTACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTTGCGTCGCGTT
TTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTAACTCCAACGCTTGTGCCCTTGCCACCTTGTAGTGTCGCTGGATACGGAGCCTCCAC
CGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGTGTCGCTTTTTTCCAGGGTCGACCGAGGATCCCAGCCATGCACTAAGAAGAACGGG
GTTTCGTTCCTCGTCCGGTCGTGCGACGTGTTTAGCGCGAAGGTAAGACGCTCGGCGTATTCGTCCCAGTCCCGTTGGTCGACGTCCGCGATGTACATCT
TGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGGGGACGATAAGCGAGCGTCGCTCGCTGTCTCTGACCCATGAGTTTGCT
GAACGCCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCGGATAGCCTCGCTCGCGCCGAAGCGCCTGAACACCGCCTCCTCGTACGCCTCG
GCCACCGTCTGCGCGGTTCGTGTTGCATTCGCTTTGACCACGACAAACCCCGTGAAGAGGTCGACGCAGACTAACAGCTCTGTGTTGCCTTTGTAGGATG
CCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGCGACGATGTTGCCCGGCGACTCGCCCTGGATGGTCGGCCGATCCTTTCC
GGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAGATCCCTGGTCAATGGAAGTGGCGCCTCACGCGTTGGTACGTGCGGCCAATA
CCCTGGTGTCCGCCCTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAAGCGTCTCCGGGATCACCAGCTTCATCATCACATCCCGATCCTCGG
CGGAATCGTCACTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACTGAGGCGCAAGCTTTTGGCAGTTCTTCACCTCGCGCCGAGATAG
GTCTCCGACGTCGCTGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTTCTGGGCGACGCGGATGCGGTCCAGGCGCAGTCGTTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGCAGCTTCAGCCCCGGGGACTTGCAGTCCATCTCGTCCCGCATCTGCCTGATGA
CCAGGTTGGAGTCTCCGCACACGACGAGTCGGGTGACGTCGTCGAGTTCCTCTAAAAGAGAACATCCGAGCAGCAGCCCGCGGTATTCCGCCTCGTTGAC
CGTGAGGTCCGTCGCATATCCCGACGCGGCGCGCATGATCTCCCAGTTCGGCAGCTGCCAAATGACGGCACTGTATGCTCCGCCCTCTCACTTCGCCTTA
GCCGATCCGTCGGAGCTCAAGACGTGCAAGACCTCGTCGCGCTCCACGTCGGGGACTGGAATGACTACAATCCTGGACGCCCGTTTCCGGGGGGCGATCT
CTTCTAGCGCTGCGTCGACGAAGGCTCGCGGTGTAATGCTCGCGTCCAGCGCGCCGAGGAGTTCTTCTTCTCCCTTCATGGATCGGCAGACTTCCAGCTT
CCACGGCGAGAGGATCGCGGCCCACTGTGACAGCCGCCCCTGTAGTCCTTTGGACCGGAACAACCAGGCGAGCGTCGTGGGACGTGTCAAGACGCGGACC
GGTAGCATCGTGTAGCACTCGTTCAAGACGCGCAACAGGGCCAAGATCTCCTTTTCGACGATGTCGTAGTTCAGCTCGTTGGGCTTCAGCGCACGGCTGG
TGAACTTCACAGGCATGTACACTTCGTCGTGGACCTGCGTGAGCACCCCTGAGATGGCCCAGTCGCTGGCGTACACGATCACGACGGATTCTCGGTTCGC
GTCGAAGGGCTTCAACATTGGGGTCTCGGCGAGTTTTGCCTTGAGCGCGTCGAAGGCGCGCGTCGCGTGCGTCCACGTCTCATGTCCGTGGACTTCTGGA
CGCTTGGCGTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTTGCATATACCGCAAAGTCTGCAATGAACCGGTGGTAGTAATTGAGGCTAC
CCAAGAACGATTACAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCAGCGACTCCAGATTCTTCGACTTCGCCTCGAGACCGAGTCCTGAGACTCG
GTGGCCCAGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGATGGACAAGTGCCGCTGCTCGCAGACATCCTGCAAGCGTTCGACCTTC
TCGCACAGGTCGTCCCACGACGTACCCCCGATGAGGATGTCGTCGATGTACGACCTCCGTCCCAGAACGGAGTGAATACCTGGCTTCACCGGTTCGCCGT
CTTCAAAGACGTCCTGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCGTAGAGCGCGTTGTCGATCAAGCGTTGGTAAATCTGCGGCGCGTTGCACAG
GCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGCTGAGGTGAGCCGGGCCCGGTCTGTCATGGGGACGACCCAGAAGCCGCTC
GCCATGTCGAGGGAGCAGTACCACGGATACTTGTCCAAGTCTTCGAGCAAGTCGTGACGAGCGGCATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCCACGGCGACTTCGACTTCTGGATCATCCTCGCGCTCAGCAGCCCTTTGATCAAGTCGGCGACCTTCTCTCGAAACAGC
GGCGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCACGTCGATGTCGCAGACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGC
CGATCAACCACTTCCGTCGCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCCCGTGGCTTCCTCGGGCGGGAGTCCAGTCGGCATGCCGACCTTCAA
GTCCTCGATCTTCACCTCGGCGGTCAGCGAGAGATCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTACGAAGAGGCCGGACCCCTCGTGG