Description :
From Genome Similarity Track
Location :
Scaffold_195:203- 2374
Transcript NameFunction/comments
Phyta_totarag5383conserved hypothetical protein

Sequence
2171 bases(100 bases per row)
TCGCTCGAAACTCCTTTCCGATCGAAACACCTCACCTGCGACGTGTGTACACTCGATCCGAACACGACCACCATCGCTTCCTATCCTCCGTCTATTGCAA
CCACCAGTGTCACTAGCTTTAAcggtaaaaaaaaaaaccaCTTGAAACATGGCGAACGCACTGCACATGTACCCGTctgtggcgctgctgctgtggagct
ggtgcacgGGCATCGTGCTGCAAGTCATCGGCATGCTAGGCTGGTGGGCCTATTGCCACGAGAGAGCTGCTCGATTGCGACACGGACGCCACTACAGTCC
AGTGGATCAGGATGATGCAAACAATTACGTGTCGACCGCAAGGGATCGGAGGGCGTCGGAGGACGTGCCGAAGCTGAGTACTCGACGGCATTACACAGCG
ACAGAGGAGAGTGTAacgaaggaggaagaggcagTGAGACCGAAACCGAAACCGGCGCGTGCAGGAAcagaggacgaagacgaggaagagagCGACGTTC
ACGTCTTCAAGTGGAAGCAGCTAGCGCGTCGTTCGGCGATTGCTACGCTGTTGATGGCAGTAGTTAGTGTAATTACCACTACGATTGTGCTTAAACTACG
TACCGGGTCCTATGTGGAGCAGCCGTACGAATGGTACGCGCTGGAGAACACTGGGAAGAGAATGTTTCAGGACACGCACAATCTGCCGGTCAATATCATG
GACACCTGCAAGTTTAGAGACGCCATGGCTGACTATACGGAGTTCCGCACACTGGATCCGGTCGTTGAACGATACGCTGAATGGAAGAAGCACCGAGGAG
AAGCCGCACCGGCTCAGCAAACTGTAGTGTATGTGGTTCCCTTCGACTACAACCACATGCTCGACCTGGATCTGGATCAAATGGTCCCTATTGTGGAGCC
GCTGCCCAAGTCGTGGACAGCTTCCAGTTCGTCTGGTGACGGCGAcagagatgctgcagctcttgtAACCTCGGGCTTTGTTAAGGCCCGTCCGGTGGAC
GAGATTACACTGTTCCCGTACTTGTGGCATAGCCTTCTCGGACCCTACTTCGACCCCCGTGTGGAGTCACCTGCTGGTGAACCTTGGACTCGCACAATGG
ATGCGCTGAATCTGGAGTTTCGCATGATTCACAACGCACAGGAGCTACGCAGTTTGCCTGCTAAAAGCAATCTCTTGGTTGCAGCTCAGTCGCTCGACTG
TGTCAACCGCTTCTTTGAAGATGACGCGCTTCCACCTGAACCTCGTGTCGGGTTTCTGACGTTGGCGCAGGAAAACTGCAATAATCCCAACCCCGAGCGC
TTCTTGGACAACACAGCCATCAAGTTCGGCCTACTGCCATACGGCGACTGCGCTCTCGTGGATGGCAAGCGATTCGCGTCACTGCCACTTGGGCCAAGCT
TCGAGCATGGTTTCCCTCTGAACGCACATCACCTCAaccctcctcctcctcttgctACTGGTATCGGACGCAAATTCCTGCTCAACCTCATGGTAAGCTG
GACTATTGAGAAGCCAACGCGTGTGCAGGCGATGATGGCGGCACTGCAAGTATGTGGTGACCTCCAACACGCCACACGAGCCAACTCCcgacgctgcgtc
gtcgaacacAACGACATGCTGTTCAAGGTTCTGCAGGTGATGGACAAGCGACTGGGTACCGCTTGGCGCTGGTATTTgtctgctgcacctgctgcctATG
TTTCCACGCTACAGCAATCTGTGTTCACGATCTGCCCGCTAGGCAAGAACCCGGAGCAGTATCGAATCTGGGAGGCGTTATCTTCCGGGTCGATCCCTAT
CGTGGAGGAGCTACCAGCGCACTGTCAGCCTCCTGGAGTGTTTTATCACCCGGCGTATCCTGATACATGGCGCTGCGTTCCTGAAGACGTTCATGGCGTG
CTTCGACGCTTGAACGCACCTGTGCTCTTCGTTAGCGACTGGAAACGGGATCTCCCACGCTTGATGAACCAATATTTCAAGAAGTCGAACAAGAACGGAG
ACACGATATCAACGAATTCCACGCAGAGCGAGCACGACAACAGCGAGTGGGGGGAATGGACCCCAACGGAAGAACTGCTGGCATTGCAAGCACGTACTCG
TTCGTGGTATGTGGGTCTCGGTCACCATTTGCAGTCAGACCTCATCGATAAGGTCATGACACACTTTGCAG