Description :
From Genome Similarity Track
Location :
Scaffold_3886:203- 1858
Sequence
1655 bases(100 bases per row)
CTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGGCTTGGGAAGGTCGATGGTGTAC
GACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCG
TGTCTAGCAACACTAAGTCACCAATCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTTCGAGTACTCCTTTTGCTTATCTTGGGCCGCTGCCATGGC
ATCGCGGACCCTGCTGACAATGTTCAGCTTGGAATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCAGATACCTGGGAGGAAAGG
GCTTGCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTAGCGGAAGCCGCTCAAGAAGAACGGCG
TGAAGCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAGCTGGGAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAG
ATTGTCCTCGAGCACTCGATTGACGCACTCTGTTTGGCCGTCGGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGAGAACAGC
GTTTTTCAAAACGCAGCAGTGAACCGCGGGTCTCGATCCGAGACAATCGTCTCTGGGAGACCGTGATAGCCAAACACGCCATCGACGAACAACCTTGCGG
TTTGTTCGCCCGTAACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTACCGTGTCCGTCGGC
GGGAAGCCCAAAGATGAAGTCAAGGCTCATCGACTTCCAACAATCAGCCGGACGGGCAGGCTCTGTAGTGGAGCCGACGAGTGCCCTGCGGGTTTGAGCC
GCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTGTACATATGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCC
CAAGTGTCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCGAACTCCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCC
ACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCACTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAA
GGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATA
GTCGGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTACTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGCC
ATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGTCTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGTGAACACGGAACTTCA
CAAGGGCATATTTTATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGTTC