Description :
From Genome Similarity Track
Location :
Scaffold_3164:203- 1585
Transcript NameFunction/comments
Phypl_g15659hypothetical protein

Sequence
1382 bases(100 bases per row)
TCTACCTCGAATCGTCCAGTTCCTTCGTCTGGTTTCCAGCTATCttccggcagcagctcctcatcGAAATGTAGTCGGTCGCTCTCGGCGAGTCCGTCGA
CCAAGTTAGTTGTCGGTCGCTCGCTAAGTcccgtcaccttcttcaaTCGTGACACATGAACGACTGGGTAAAAACGGTATCCGCTCTTGTCCGGCAATTC
CAACTCATAGGCGAGTTCCTCAATCTTCTGCTTAACTCTGAACGGGCCGTGCCATCGATGCGccagtttcttcttcagccCAGGCTTCACTCGTTCCATG
AAGAGCCACACTTGATCTCCCACCTTGAAGAGAGATTCCTTGGGCTCGTTGAGCTGTTTCTCGGTTCCTGGCTCAAGTTGGCCTTCACTGGTTTGATCAG
CTCCATCCGATCCACCGATAACTTCGTTCGCCTGGTCCGGTACGGCCCTTTGCTCTACCCGACTTAGCGACTCGTtgtgctctcgagctcgtcgagcttt
cCCCTTCAGCTGGTACTCTttcgccagcttcagtgCGATTTCCCGCTGTCGATTAGCCTCTCGACGCCACTCGACTGGGTTCGCCGAGTCTACCACTTTT
GCTGGGTTAGCCGAAGCTCGTCGAATCGAGGAAGTCATAGCCTTGAGCGTGGATTGTGCGTCCCAGCCGTGCACTAAGTAGAATGGGGTCTCTCGCCGAG
TCGAACCCCTGGAATTGTTGATGGCATGGACCAGTTTCTCAGCGATGTCGTCCCAATCTGCTTGCAGCGGATCTTCCACATAGACTCGCACCGTCTGGAT
CATCGTCTTGACGCTACGTTCCTGCTGTCCGTTGGCTTGGGGCCTGTAACCTAGCGTAGCTCTTGACTTCGACTGTATCATCTCGGCGAACGTCTGGAAG
ACTTCGCTCATGAATCGCGGATCTCTGTCGTGTCGGATCAGAGACGGCCCTCCGAAACGCCGAAAGATGCATTCCTCGAAGGCTTTCGCCACTTCTAGAG
CCCCTGTCTCGCTCATTGCCTTGGCGATCACGAATCCGGTGAAGTGGTCTTGGAACAACAATAGGGGCTGTGTTCCCTCGCCGAGTCTTCGGTAACGGAA
TAACAAATCCATTGACACAATCTGGAAGGGTTGGTCGGAGACCACATTATCCGGCGCATATCCTCGAAGGTGATGCTTGcttttgctggtgttgcagtcT
TCACATGCCTGAACGTGCTTGACCACGTCTGCATACAGTACAATCCAGTGATAGTCGGCTTTCACCCGGTAGTACGTCCTCACGATGCCTTGGTGGCTGC
CCTCGATCGAGTTATGGCAGTTCTGcaggatctcgtcgatgagaGTCGTTGGGACTACTAGCCGCAGACtcgtgtcctcctc