Description :
From Genome Similarity Track
Location :
Scaffold_552:203- 1562
Transcript NameFunction/comments
g10068.t1hypothetical protein

Sequence
1359 bases(100 bases per row)
ACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCACAGTGCGTAGTGACGCATGATCAGTAAAGATGACAAATGG
CTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTAAGC
TGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCGATGTCTGCTTGCAGCAGTGCACACCCGATGGCAAAGTCCGATGCGTCACAGACGACACTAA
ACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACTGCCTCGAAGGCAACTTGATGCTCGGTGTCCCAGGCCCACTC
CGCATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTATAGTTGGCGAGGCCAAGCCACTTGCGTAAGTCCTTTTGGT
TCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGCGGGATCCGCTCGAAGGCCGCGCTTTCCGATGAAGCACCCTAAGAAGGGGATCTCTTCAGC
ACCGAAGATGCATTTGGATGCGTTAGCGTACAGCTTATAAGTGCGCATGCACTCAAGCACCGCTCGCAAATGGCCTATGTGGTTGTCCACATCTGACTTC
CCGTGCTCCGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGAAAAGCTGCGTCACTAGACGATTGAACGTCG
CGGGCGCATTGGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGCTGTCAGCGGAATGTCGCTCGCACGCATGAG
CAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGTGAACATTCTTCCTAGGAATAGGCGTCTGCGCC
GGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGTGCCACTTGCCGTTTGAGTTTCTGACACAGAATGTCGGCGTCGAGTGCGGAGACTTGC
TCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGGCAAGGGCCACTGCCTTGTTACGCAGTATTT
GGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTGGAAACGACATCTTGGTATTCCTTAACCAAG
GGATAGTATGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGC