Description :
From Genome Similarity Track
Location :
Scaffold_116:2029- 5027
Sequence
2998 bases(100 bases per row)
CACTGCATCCCCGTGCATCCCAAAGAATAATTGTGGACGTCATCATGGTGACCAGCCACCAGCGTGAACCGTACCCCTTCCCCCCGGATAACGTACATGT
ATTAATGCTATGCCCGGGTTTACTCATTAGCAATTTGCATCCCCCTTGCGAGTTGTGTGTTCTGCATCCAAAATTGCATCCACTTGCATCCATTGTCCCA
GTTTATCCCATTTGGGAATATCTTAACTTCAACCTGGCTTGTCCCAGTCCAGTAGAATTCCCTCATTAAAACAGTGTCACTGTTGATTTCTCAGAAAATA
CTGCAATTTGAGTGCTTATATGGAACATTGTATTCTCGGACCCCGAGATTTAATATTGGATGTACTCACCAGAGGTAGGATGGATTACGAAATGGTGTAT
CCGGATGGGATAACTCCTAGCATTTCGGGTCAAAACAACAATGGAACAGTTTTATTCCCTAGCGGATCCAGCACTATGTACTACTACGTATTAATAGTAA
CTTATTAATACCCCGCACTGGTAGAACTTGTATTCAGCTGTCAATTTCGATGCCACTGGAATATTTGCAATATACACAACAGTAGCTGTTGTTGTTAACT
GTGACGTGACGAGTACAGTCTGCGACGGTAGACAGTAAACGAGTATTTCAACACGTTGGTTCAACCCTTTCAGCAGTGAGGAATGTCATGGTCGGCAAGT
TGCGGCAGCTAGTGTGCTGGGTGCACCGGTTGGTTGACTCTGAGGCTTACTAATTACTACTTCGAAGTATTAATAGGAGGCATTCAAATTGGTCATCAAT
TGATAAAAGCAAGAAAAATGATACTGTATGTTTGGGCGGCCTGCAAGAGTTTCGTGTCGACATCAAAGGCTTCTGACTCAGTGAACCAAATTGAACACGA
ATAGTCCTATATGGTGGATACGACATTAAGCTACCATATAAGCTATATTACAACGTCATATTCGTCCTGTGGGCGGAGGAGATAATGCAGACGTGAAATA
CCATTTTCCCTCCTGACGTCCACTGTTGCAATATTAAATGTTCGCTGACAAATCTCACTTGACACTATAACAAAATTATGACATCAACAATACATTTCTT
GGTCATTATAACATGAAGCTGCTCATCGAAATCGTGACAAGTGCATGGTACATCCGCACGTTTTAGACGTGAAATCATGTGTTCATGTCAGTTACCATTA
CCGGTACAGTATGACGTGCGTCAACTTTCATATCAAGCGACGGCAAGCGATGTAATTGCCTTAGAACTTTGCTTGTACTTACATAGGTAGTATTGAAATG
ATGTGCTCAATTCCATCCGACGAATGTTCATGTCAGTACGAGCGAGTTGAGCCAAAGCAACGATATAAGGTTTGAATATACTGTACGAATTTCGGTACCA
AGAACTTTACAGTATCGGCCCTCGCGGAGAAATGTCTTAAACAAATGATAATCCAAACTCAATTGTCAAGAAGGGGCACTTTGGCCGTTCTTGCTTTGGC
CTTTTTTTGCCGTGGCTCGGTCACTTACGGATAATATCCGGTGTTCTTTCTCTGTAGAAGCCGGACTGTTTCTGCCCAATCATACGTCAGCTAAGCAGTC
TGTTAATGTTCACTTTTGGTTTTGTCCTCGACCACACAAGTGTTCTTCGTCGTCGCTCCTCCTCAGTGCTACCCCCTTTATCCTCCCTCTTGACAGGTTA
TGAGCCTCCTCCCTTCCTATGTGCAGCCCTTCGTGGGAACCCCACTCGACGACCTCCGGCCTCTGGCCTAGACCTTGTGCAAGACAGAACATTGGATTGT
TGACTCTGGCACCTCTGCCTCATGCACCCCCAACCGAGATTATTTCTCCAACTAAGTAACTTGCGCACTGTCTCTTACAGTCGGGAGGAACGGCGCCCAA
CCTCCTGTCCTTGGCTATGGCCCTCTTTCTTTGGCCGTGGACATGTCGTCCCGTGACCAAGCTGACGATATTCGTCCATGCGCTCTGCGCCTTACCTTTG
GCCTACATTGCCCTGAGCTACAGTTCAACTTGTTCTCGGTTCGCCAAGCAACCGATGAAGGTATCGCAGTCCGTTTTATGGCTCGCGCGACATGTGCGAA
ATTACCACCTCTCTTGGTGATGTGCTTCGTGCACCTAACAATGCTATGGGTTTATACTATTTTCCCTGCCAGCCCAAATGCGAGCCCTCAACCAATCCGC
ACCGTGGCGAGTATATCCATCCTGGCCAAATGGCTATGCTTACTGGCATGATGGCTACTTTTGAGACCGCTCTGCGGAAATTCTCCTCGCCCTACAGTGG
ATTTTCCACTTTTAACGATCAATTGCACATGTTTGCATATTCGTCTGTGTTGCGCTATGCGCCAATCACTCAACAACCATCTATGGTCTCCAAGCCATCA
CCGTTCTACCCAATTACCCCAGACTCTGTCTCGATGAGTGTAGCCCAGGCTATGCTTGGTTCACACACTTCCACACCTGTCTATGACACTACTACTGTTC
CAACCGACTGCCTTATTAGCCTCGTGGCTGACTCCAAGCTATCGGCATCTAGCCTTGCGCGTCTATGGCACCGCCGTCTTGGCCATCCAGGCGTTGATGC
CTTCAACCAAATGACAAAGACAAACCCTTATGCTCTTCAAGGCCAAGCACCTTCGTGGTCAACTATGTGAAACTTGTGCTTATGCCAAGTCTAAGCGCAG
TCCTTTTGACTCATCTGCGGTCTTCCGCGCGACCTCCTACCTAGCCCTCGTACATTCTGATGTTTAAGCCCGATTCTGTCGGCGGGTGGCGCTGCCTACT
TTGTCGTATTTATCGACGATTACTCCCGCTTTATGTGGACTTACCCCATGCGCAAAGATCTCTATGAGACCTACGAATTATTTCGTACGGACGCGATGTC
CATTTTTAAACTTGATGTTTGTGAGCTACGCCACTCATCACCTATGGACATCGGCACCCTTCAAAGTGACAATGCGAAAGAGTACGATATACGAGAAA