Description :
From Genome Similarity Track
Location :
Scaffold_23:20286- 31604
Transcript NameFunction/comments
Phymu_g1484vacuolar protein sorting-associated protein 8
Phymu_g1485hypothetical protein PHYSODRAFT_299325
Phymu_g1486hypothetical protein PHYSODRAFT_299326
Phymu_g1487hypothetical protein PHYSODRAFT_494773
Phymu_g1488BCCIP family protein
Phymu_g1489hypothetical protein
Phymu_g1490conserved hypothetical protein
Phymu_g1491hypothetical protein PHYSODRAFT_299329
Phymu_g1492glutamate-rich WD repeat-containing protein

Sequence
11318 bases(100 bases per row)
TTGCAGATGAAACCTGCTGCTAAGGCAGGAGGAAGCGTGATCTACAGCGTTGGTTCGTGGCGACTGGGAGACGACGGATCTATCCATCGACGTGGTCGAC
TCAAGTATTCGACCGGGGATGTGTACGACGGCGAGTGGGTTGATGGCAAGCGTCATGGGCAAGGAGTTGTCACGTTTGGATCCGGTGGCAGCTACACGGG
GGAGTTTGTGGGTGGTCTGTACGAAGGTTTCGGCGTTCTTCGAGTGCCCAAGTCCCAGCACCCGTTGACTAAGCAGTGGCTGAGAGGGGAGAAGTACGAG
GGCGAGTTCTTACGCGGATTCAAGCACGGCCATGGCACGTGGCAGACTCGAAGCGGCGACCAGTACGACGGTGAGCTGAAGCAGGGGCTATACGAAGGTA
AAGGCGTTTGTGTAGATGGTGCTTCGGGCGAAGTGTACGACGGAGAGTTCGTTAGAGGCTTGCGACACGGACACGGTAAGCTTCGCTTTCGCAGTGGGTC
GATCTACAGTGGAGGATTCCGTTTCGGCTACTTTCACGGCTTTGGACGGATGAGTTACGGTTCTAGAGGAGTTCACGGCACTTATGTTGGGGAGTTCGTG
GATGGCAAACGACATGGGCAAGGTGTACGCACGTACGGAGACAACGAAGCTAACAAGACAAACAAAAGACGGTACGAAGGAGCGTGGGAAGACGACGAAC
CTCATGGTGCTGGCGTCCAAGAGAAAGATGGATGCACCGCAGTGGGAATGTTCGAGTGTGGGCTGCAACAGGGTCCAGGAGCGATAAAATTTGCGAACGG
AGACACGTACGAAGGCGCTTTCGAGAAAGGAGATCTccatggagaaggacgctTTGTCTATCGGGATGGAGGTGTCTATGAAGGTACCTTTGTTCACTCC
AAGCGCCATGGTAAAGGCACACGCGTGTTTGCTAACGGAGATCGGTACGAAGGCGACTGGATGAATGACCAGATGCACGGGCGAGGAGTGAAGACAAGCA
AAATCATCACCAAATCTCACAATAAATGGAAGAACGACGGTGGAATCGGGGTTTTAGTCTATGAGGGAGATTTTTACAACGGACATCAAACTGGAGAAGC
CAGCATCACCTACGAGTTTAAGCCCCAGGCCTGTGAAGGACCAGAGAAAGAGAACTGGGAGTGGGATGGCGAATTTGAGTTTCCTGAGGGCTCAGGCTCT
TGGCATCGAGGTCGAGGAAGAACGACGTATCAAGGTGGTGTTTTACGAGGCCGTTTCCATGGTCAGGGCTGTTTGCGCTCTCCTGATGGGAAGTTGTGGC
GTGGGGAGTGGGTCAACGGACAGCTTCACggtcgtggagaacgtgTTTACCTTCCATTAGCGTTCGATACGCTGATGACAAAGGATATGCTGGAAcagaa
gacgtcgaactTATCGCTTGCAGGAGCGCGCTTGGGACTTTATGGAATGGTGCGATATGTTGGCGAGTTCGTGAAGAATGTacgacatggagaaggcgag
cTGCTGTACACGAATGGTTGTCGACTCCGTGGGCAGTTTGTCAATGGATTTGTGGAAGGAGTAGCCTGCTACGGCCTCGGAGGTCAAGGAAACGCTGGAC
GATGGAGATATGGGGAGTTCATCCGCGGTGAGCGTACGCGTTGGCTTggggaagaagaggagggGGAGATACTGCAACGGAAACACGACGAAGAATCCAT
TGAAGGACGCAAGCAGAAACTGATGCAAACGATGCTGTCAAGGGCGTAATTCAACGAACACAGTTCTATTCTATCGACGTCACTGTTACAGTTCTTCATG
GCCTTCAGACCGGGACTCCACCGCCTTAAGGAACGACTTAACCTGGGAGATTTCGGCCTGCAatgcgtcttcttctgctccttcgcACGCTGCCGGCGTC
TCGAGGCGGATCTCGTACTCGCACATCTCCCGCTCCTCCACAAAAAGTACACGGTTCTTGACCCCGCACGAGAGCTCAACTCGCGTCTGGCGCTCCTTCC
CATTAGTACAAGGTTCTCCGTGGTTGTAGCTCTGCACGCGCACAAATCCAGTCGAGTCTTGCCATTCGTTCCAGATCCCCAGACCAATAGGACGtggagt
ttcttcttccttttcgTTTCCATCATCTGCACTAACTCCCACCTTCGTTTGACGCTCAGCCTTCGTCCACTTGGAATACAATGGCTCAGCCTGCGAGACG
TTTTGGAAGGGACAGAGCACCATGTCGTACTGGCGAGGGATCACGTTAGGGGTTCCTCctttcagctccttctcgtccacagTGTACGTGAAGCACTGAC
CCACTAACTCCACAAACGCAGGCTTCCAAGCCGCGTCCGAGAACGTGCTCTGGTCAACGACACGACTCTGGACGTACGTGACGTACTGCACTCGACGCAG
CACGTTGTACGACTGTTCCAACTGTCCTTTGAGCTCTGGGTTGTGTTGAGCTCGCTGTTGCAGATCCTCGAACGCTCTTTGGCCTGCCTGATAGGCCTCC
GCCAGCCGCTCAAAGTCCtcgtgaagatgctgcacCTTGTCCACAGCTTGGATCAAATATCCCTTGCGAATAGTCCGGCCTCTCTGCACCACCTCTAGCC
TCTCTTTTAGCGTTTTGAGCCTCCCATTCCATTCAGACTTACAGGTGTTCGAGCAAAattcctccttctcgtcgctgccgtcacAGCAGTCACACACCGC
GTCATTCACAAAGGCTAGTGGCACCAATTTGTCGTCGGCTTTGCACTTGAATTGTCGACCGAATGGGGGCGTTTCTGAGTCCAGCAAAACATGGGAACAC
GCCGACGTGTTGGGCTCGTCACTGCCGTCCGCACAGTCGCAATagtcgtcgtccagaagctcaaTCGGAAGCGAATCAACGCAAATTCCCTTGCTCACTT
CAGTATATGCCCTGTCTCCtttgttctgctgctgggagaGTCCGAGAATGGCGGCGTCATCCATGAAGTCCcagtcgtcgtcatcctcgtcttcgtcttc
gtcgaaTGCTTCACCAACTCCGAAGCGTTTGGAGTCGCGAGAAGTGGAGCTAGCAGCCGACACACTCGGTACTTGAATGGCTAGCACTAACATGCACGCG
ATGGCCACAACGACGGCCATGAggagcgccagcagcgatCGCTTGGTGGCTCTGGACGCCATAATTGACACAAATGACCCGAAGAGCTCCGGAGGACGGT
GATTGGAGGGAAAAAAAACTATGTTGACCCCTATAGATCCACTGTTTTACTGAAGACTGCTTCTCTCGCATCAAAATTCCTTTCTCATGGAGCGTTCAAA
CGCGGCCAATTTCGTCAAAACGGAGCTGTTTGGTTGAGAGATGAGAGGTCTCTCTCGTGCTTTTGCTTAGCCAGGTGGAGAGAGGAGGTCagagcagctc
gttcttcacCGTCGCTGAACTCAATCAGCTCGTCTTCAGTGCTTGACATCGAGGCTTGGCGGcttttcttctcgttctcaTCGAGTAAATCTCGCCCGCC
AGGCTCCCAGTTGTCCTCGTCCGAGATAGCGACCCAATCAGCTGCGAGATCCTTctgcacggcgtcgtggaCGCTTTCAGTTTCCAGCAAGCGCGTGTCT
CCGTTCGATAGATCCACGCGAGGTGTCCCCTGTAGACAGCCGACTACCTCAGCGACCGAAGCCGTGCCCATTCGCAGCAATTGCGCCACCATCCGACCca
cctgcaccaccacaagctTGGCGTACAGGAGAAGCTTGTTGACCAGCTCCATGCTCGAGAATATGAGACCCGGCAGGCATTTTAGatacaacttcaactt
cagtaGCCAATCAAACGATATTATTTTGGTGTGGACTATTTCGTTTTGGTCTCAGATCAGTTTCACCACTACTACGAGAGGACAAGGTAGTTAGCGAGTT
AGCAGGTATGAAGAGCAACAACAGAGCCGATCGAGGCCCCAGATATTCCAGTAGCGACAGTAGTTTTAGCAGTGAAAGTGACGTTGATAGCAGCTGCGGA
TCAAGTGACGATCTCGACCTGGGACTGAGCGGGACGAGCGAGGCGCAGAAGTTTAAACGTTTGCGTCGCATTTTCCTGAATCGTCcggtcaagttgaaga
agaaggacacgAATCAGAGAAACAAGCACAATCCAAGACACAGAAATAGCCCTTCGTTAGAGAGAAGATCGTCTAGAAGCAGTGTGGCAGATCGACAGCA
CTTGCGGAGTGAcaccagctcaagaagcagcagtgcaaCGGGTGGAGGAGCAATGGATATACTTAACAAACCTCTTCCAGATAGAGGGACTCgaccactt
caagcagcaattGACCAGCACATGAACGCATTGTGGGAACAGAAGAAGCGGCATTCTGCGCAACGAAACTCGAGTGAGTGTCAACCGTAGAAGCCCTATT
TGTTGACATTTTAGTAATATGTTGTAGCTGCCAACCAGGTCGAGAATATGTTGGAGCAAGcggtggaagagctccagttcctccgGAAACAGGAAGAGCG
TGCATTAGAAAATCAAGTGAGGGTTATTCGAGAGGTAAGCGCCATCCATTGCCTTTATATCTTCAAACAATCAGTTCTAATGCGTTCTTTTCGCACTACC
AGACCTACGCTTTGCGTCTTGAAGTTTTCCAACAACAATACCTCAACAAAGTTGCCGAAATCGAAGACGAAATGTACGCGTCCATACAAAAGCGTCAAGA
AGAGTGCGACTCCACCATTCTGGCGGCTGCCAAAAAGCTACAAGACCAGACTCAACGCGCTCTGGTTAAAGATTTGGCCACATCGACTGGCGAATCGAGA
GAAGAACAGCTCGAGTCaagctccatctccaccGACTGCAGTTCAGCGAGTCAACCGAAAGCACAACGACATGGAACCGCTCGACATGACTCGCTCCGCC
CCCCTCAAGCTTCTCGTGTTGTCCCGGTGGTTCAGCAAGTCTCGCCAGTTTCGCAACAACGGGCGAAATTGCAAGCTCTGGAGGATAAACTAGCTGCATT
CTCACCTGAGTCTCTGAATCGAGTCAAGAATGAGTTAGCCACTCCAGTCCGTCGTAGCAAGATCGAAAGAATCCCGTCGAAACACGAGCGAGAAACAGtg
tcgagctgcagtcgctcgatAAGCTTCAATGATAGCCAGCACGAAGAAACTGCTCGTGATGCTGACGAGTGGAGAGCTTCACCACTGTCTCCATTACGAA
ATGGACCTTCGTATTGGAGAAACGGCATATctctcgaagctcgagacgaCGAAGGGAACACCAACAAACCGGCAAAAAGTAACAGAACGTCATTTTCCGA
GTCTACAGCGCCTCTTTTGAGCAAGCGCTTCCTTcgacctgaagaagaagaagagctacGCCGTCTACGGACAAGTATTGGTCTCGCTAAAGACTGGATG
ACGAGACACAGCCGGGCATAAAGGAGAACATGAAAAACAAAGGGTCAATAGAGGCAGAAACGGCAGGAGTCAAACGCGAGCGCTAAATATTCTAATTACA
CGTTGATCATTGCCGAGATACTAGCCAACGCGGCCTTGTGCTTTTCacgctcgagcagcatcacTACCGtggtcttgctgctcttATCCACTCGCTCACG
CTCAGTCAACGGTGTGTCGAAAGAGAAAGAGAGCtccgcctcctgctcgagGAACTCGTCCTCGAAGTTGTGGAAGAACTTAGCTGTCTGCTCATAggtc
gtcttggtcttctttcCCTTCTtggagtcgctgctgccgctcttctcctccgtgCAGGTGGCCAGGATGAGGAAGTAGTCcatcttgaagctgttgcgca
gctcctgcgtgTCTTCGTTCTCGATGGCCCACTCAATATCCTCGTGGAGAGCCGAATGAAGTGCTGGCACGAGCTGGTAGGGCAGGTTCACCATACGCTC
ATTTAGCACTAGCCCCACGTTCTTAGTACTcaggatctgctgcagcttgagctgctcagCGGCTGGACACTTCTTGGTCACATACTGCAAGACCTGCTGG
ATACTCGTTTCATTGGCGAAGCTTTTGAGGTTCAGAGCAGTGATGAAGCCATAGACATCATCCTCTCCCTCTGCGCAGACCATCGTACCAGCCGTAACTT
GGCCCACAATGGCGTTGGCAAGTCCAGAGACGTCGAAAGGATGGGTAGGAGGCAAATAGGCCAAGAGGAACTGCTTAACACTGTGGAAATGGTCCTCGCG
AGGGTCTGAGAACAGGAAATCAACGTTCACATTGccaccggcagcagcggcctCTCCTCCGTCCATTTCATCGTCTGAatcgccaccagctccaccgttG
GGGGTAGCAGCGAACGTGAggtcatcgtcgctgtcgtcgctgctgtccgatTCGTCCTCCATCATTTCCACCTCGTGGTCTTCATCTTGGACGGTTTTGG
GGTCGATCGGTGCCTTGCCGGAGCCACgcgagcgcttcttctggGGCGGCATCTTCCTGCTGATTGTCAAGTGATGCAGTCAAGTTACTGGCTGGCACGT
TTTGTACCCATTTTCTGAATAGAAGACCTCTCTCGAATAGAATACCCCATTCGGTATCTACCGGTAATTAACATTATGGTATGGATATACCGGTCCGGAT
ACCATTATTTTCCGTTTTGGTACGATGGATGGCTCGTTCGTCCCGCCGCCGTTTCCATTCCCAGAGGCCTGGCCTAGGGTATTCGCTAAGCAGAAGCAAC
GACAGGAGAGGCGATGGCTCACACCAACGACGTTTGAAACAGTGCAATGGCCGGTaccagtagcagcagaaTATTATCATCCAACGGATCCGATCCTTGC
CACGGATGTGCAAGtagaagacgacgatgaaaaAGCGTCCGAGTACGAGTACGGATACGTGCTGAGTGATGCGTGGCGAGAACGTTTCCAGTCGTCCATC
CACTTGCAGCACCCACAGCAAGAGCAACCGAGCGCCAGAAGCAATAAGAAGatgcacaagaagaagattaagcagaagaagaagacagccAATGcggaag
ctgttgctgctgctagtgcaAGTCGATCTGGTCACTTGCAACGTGAAATACAAGCCGCCAAGACGCGCGAACTTGCACGGAAGTGGAAGCGGCGAGGTGG
TagcgatgctgctgctctcgggCCGCGGGTAACAGCATTGGAGACGTCACTGAACGCACAGTTCGACGAGTTCTGCGACGTATTCCAACCGGTGGTGTGG
CCGCACGATCCTCTGCAGAGATAAGGGCGATATAGAGCGAGGAAATCAACAATTGCCACAAGTTGCAGTCCGGCTCAATTTGTGAATATTTTGGTGCTCA
CGTAAAGGTCCACACAAAAGACAGCCAGCTGTTTATGGATTTTCGTTATCCGGCTGTCCGGATAAGAAGGGGGAAGTCTCATTTTCATAACAAAAAACAA
AGAAGCTTGGCCTGTGTATGAGCGAAGTGGAAGCCGCCATCATGAACCTCGggcagctcaagaacgaccCCGCCAACGGCTCGGCGCAGGCTATCCCGTC
CCTCAAGCGCACACTAAGCGGTGGCGCGGCCGGTACCGTGGGCCATGGACACGCTGGAGGACTCGCGAGCCACTTGGGCATGAACAACATTAACTCCATC
CCGTCGGTGCTGCATGCCACGTCCAACACGAACCCGCCGCAGATGCTGCGCGCTGTGACATCCTCGGGTGTGTACAATCGCCCGTCGTCCAACCAGGCCT
TCCGCGGGGGCAACAGCGGTCTTTCCACGGGCGGTGCTGGCTCGGGCAATGCTGCGGCTAGCACTAACGTCAGTGCCACGACGGCCACACGCAGCGTCTC
CCAGTCTTCTACCATGCAGGACTGGAGGATGTACCTCACTATTGAGGAACGTCAAGCTGTGCGTTCCAAGATACGCGATGCTTACACGAGTCGCTGCTCC
ACATATGAAGATCTACTCCAAGTGGTGAGAGAGAACTGATACACTGATGACAAAGGCTTTAGTTTCTGACTGCTGTTTGTTTCCTATAGGCTTGTGCTAT
TGAGGAAGAGCTGTTGCACATCTCAGCACCGTCGCGTCTGGACTACTTCAAGAGCGgcttcgagttcgagaaccGCGTCAAGCTGAAAAAGGACCAGTTG
CAGGGCCAACTGGCGGCGTTGGACGCCAAGCGGCGGTCATCGAGCATcggccagcaacagcaacagggAACCCcgggaggcagcagcagcagtggcagca
aaGCAGTAGGAtcgtccaagaagcagaggaatTAGGGCTGTGAAGATCCTGTGAGGGTCATGTGAGGTACCTTGCCTTCCCAGCGGCGCTTTTATCCTGT
GCAGCTGAGAAAGGAGTCGGAGCTCCATGTGAAGCTACGGGAGGAGCTGATCGAGCATCCGTGTATATCTTAGGTCCTGACGGGGAGCTGCAAGAGGTCA
AGCATTAAGAGAGGGCTCCTTGTTAGTTTCCTCATCAAGCGACGAGTATTTTTGGtcagcagccgaagccacAGCTAATCGAAGCAAGAatccgatgaag
aaggaacAGGAGGGGGTGTGCATCGTATACTGTATTGTGTTTGCCTTCCGAGTATTTCGGATCTCTAGTATTTGCGCAGGATATAGTGCTTCAACACCTG
CACGTGCAGCTGAAACATGTTGCGTTGCTGCAACTCGGGGGCGAAcgcgttgaagttgactgcttcaagctcctTCAAGTACAAAGAGGAACTCACCAGA
GGCAAGAATGCACTACGCGATTCACCCGGCAATTCGTTCCGAAGTGAACGAGCTTGGTGAAGGTGCTCCATTGCACGACATGCTACATCAAACACCACGG
GCGCTACCTTCTCACCGAGATTGGGgtcttccactgcagctAGCAGGTCCTCCACCGTGACGCCGTGCTGCATCGGACAAACAACAAAGCATAAGGATTC
TAGGAACCAAATCCGCAGATAGTTTTTCGCCCAGAATTTGGATCCGTACCTTGTTCATGAGGTCCTCGGGAAGGTACGACTGCTGTCGAGCACTATGATA
CGCTGTACctcgcagcagcgtcgccaaTCCGATTGCCACGCCGGCATGTCCTGCTGCACGGTCTGCTGTGTCGTGACGAACGCCTAGACACTCCAGTGTA
AGgtacagcagcgaggaggCTGTCTGTTCCGCATAAAGATCCAATTCGTGCAAGCTCTGCACCTCTTCACGGTCGAGATCCTTGTCCCGTGCGTCTAGAA
GTCGTTCGAACCACCTCCGAGTCAAATCGTGCTCCTGAATGGCTTTGTCCAAAGCTCGAAGTAGGGCGGTTGATTGCTCCGGTCGAGACTGTTGATCAAC
GGAAGACGAAACTTCGTACAGGTTGAAAATACGCTCTCGCCACCACTGAAGGCGGATCTTGCCCGTGATCTGGTTGCTGTGCACTGAGTCCTTGATGGTA
GCGAGCTCGGCGTTTAGCGCGCgctagcagcagcgaatTGTCAGTATAAAAACGAAAAGTCAAGTTCATAATAACTTTGGCATAGCAACATAcaatggcg
aagaaggaTGGCCGCGTCTTCAGTGGTAGCAGCAAGCCACACAAATATCCATCGTAGTCCAATTTCCTGTAGGAATGATATACTTTCAGCTATGGCGTCG
GTAAAACAACGATTCCCAGTGAATAATTACCTGACAGACTCGCGCAGGTCCAAATCCTCTTTGCTGTGCTtcccacgagctgctccgagCGCTCTACGAG
GCACCAGCGCCGCCGGTTGCcgccgcaagaagctcaacatgTCAGTCTCAAAGCTCGGCCGCTCGTTTGACTTGGGCACCACCAAAATACCTGCTCAATA
CCGGTTTTATTGAATTAGTGTTGTCCACATACACTGTGGTAGTAGTCTGTCATGTCACCAGAGTTACAGTTTATGACACCGGAACAGTTGATTGGCAGGC
GACTTGCATCATTGGCCTGCGACCTGTCATTCGGCGCGTATCGCTACCGACGCCACCGCAATTGCCACTGCATTGCTCGTCATCTAGTCCAAGTGGATCT
GTAGCCATGagccagcagaagaagcgtgcGGCCGCCGAGTTCTCGGGCGACATCAAGCGCCACACggcacagcagcgcgatgGCGAGGAGGACCTGGTGT
TCGAGGACCCTTTCGGagacgacatggaggacgaggaaatGGTCGAGAGCGACGCCGACgaggagattgtggacggcgaagctgctgctgataaGGACGT
GGACATGGACGTGGATGAGCAGGCCGACaagcaagtgaagaaggtgttCATGCCCGGTGTGGACAAGTtgcaggacgacgaggtgctggactaTGACAGC
AGCGCCTACGACATGTACTACGCCATGACAGCCGAGTGGCCGTCGCTCAGTATTGATGCTGTGCGCGATAACCTTGGTGCTGTCCGTACCCGCTTCCCCA
TGACCGTCTTCATGGTAGCAGGCACGCAGGCCACCAATCCCGACGATAACCAGATCACGGTCATGAAGATGTCGGAGTTGCACAAGACCAAGCACAACGA
CGGctcggactcggaggacgaggactcggatgatgaagatgagaCAGAGGGCGATCCGGTGCTGGAATCGCGCTCCATCGCTCACCCCGGTGGAGTCAAC
CGTATCCGCTGCATGCCTCAGTCCTCCAACATCGTGGCTACCTGGTCTGACCGCAAGAAGGTGCACCTGTGGGACATTGCTAAGCagctcgagtcgctgg
aTGGCAAGAGCGGCGCCCCGCTTCCCGCCAAACAGGCGCCCGTGTACACGTTCTCCGGACACGCTGATGAAGGATTCGCTATGGACTGGTCTCCAGTGAC
GTCTGGCCGTCTGGTAACAGGtgactgcagcaagttcatTTACGTGTGGGCCAACTCAGAGGGAGCGTGGAGCGTGGACAAGGTGCCATTCACGGGCCAC
AAGAGCTCAGTTGAGGACCTGCAGTGGAGCCCCACGGAGGCGTCTGTGTTCGCTTCGTGCTCGTCAGACCGTACCGTACGCATTTGGGACACCCGACGGA
AGGCTGGCAGCATGCTGGATGTTGCTGCtcatgacgacgacgtgaaCGTGATCTCGTGGAACCGCAACGTCGCCTACCTGTTGGCGTCTGGCTCGGACGA
TGGCTCGTTCAAGATCTGGGACTTGCGTAAATTTCAGGCCGATAACCCGGTCGCGCACTTCCGGTACCACACAGCTCCAGTCACGTCGATCGAGTGGCAC
CCGACCGATGAGTCGGTGCTGGCTGTGTCAGGCGCTGACAACCAGATCTCCGTTTGGGATATGTCTGTCGAAGAGGACGCCGAGGCCGCTGTGCCCGTCC
AGGGCGATAATGGCGAGG