Description :
From Genome Similarity Track
Location :
contig_5:20283- 23227
Transcript NameFunction/comments
g1491.t1hypothetical protein
g1492.t1RAW32487.1 hypothetical protein PC110_g11179 [Phytophthora cactorum

Sequence
2944 bases(100 bases per row)
CCATACTCATCGTCTCGGACACCAATCAGTCGTACACGCTGACGGGCAACGGAGACGTGCTGGAGCCGCACGACGGCATCATAGGCATTGGCTCGGGAGG
CACCTACGCTCTCGGTACGTGCAGCCTGGTGTTTAGTGAGCTTTTTATTGTTATTTTTGTGGAGATGATTGACAGCGCTGTGTTGGACGTTGTAGCCGCT
GCCCGTGCGCTTATCGACCAGGACCTGGACGCCGAGACCATCGCTCGCAAGTCCATGAAGATTGCCGCCGACATTTGCGTCTACACGAACGAGAATGTTA
CTGTGGAGATGCTGGGGGAGGGGGAGTCTGAGGCCAAGACTGACAACAAAGAGTAAGATGAGGTAGAACAGGTTGCACCGAGGCGTGTAATTCGTCAGCA
ACGCTCGAGTAAATACAAGGTCTGAGCTGTTGAGTTGAATCACCTAACCATTGCAAGCAGAACGTAACCAAGGCACAATGGCGTGTCTGAAAAATATGAA
TATGATAGTCGTGGTCGGGCAAAGGAAGACAAAGAGAACGCTAACAAACGTCACCGAAATGACTGCCATCGCCGTCTGCCCCGTGAAGGCAACGCCAGCA
TCTCGGTTGTCAGTCACAGTCCACAGTAGTGTGGCACGCGAGGTGCCAGATGTCCTTCGTCCCTCGTCCCTCGGAAATTGTGATGGTTGAAGGCGTGTAT
AAGATGTAGTATTGGTGCGCGTGTGCGTTTTCCTTTTCCTGATGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGA
ATGTCTTCTAGCGGGCCCATAACTCTCTTGAACGTTTTACGGTCCAACGTGAGACACTTAACCTTGCCCTGGGCGGTCACTGTTGCCTGACGAGGCCGAG
TTGTGAGCAGTGCGATTTCACCAAAGTACGCGCCGGATGTGAGCTGGCCCATTTCCACTGGCGGGTCTGCGGGCGAGAGCTGCTTCGTGCACACTGCCGA
GCCTTCCTCAATAATGTAAAACAGGTTGCCGTCGTCACCCTGTGCGATGATGACTTCGCCATCACTAAACGTTTCTGTCTTCAGAGCGTCTGCGACTGTG
AGACGCTCGTACTCGCTGAGCGACTCGAGCAGTGGTACACGCTCAATGAAGCCCTTGTGGGCCTCGCGTTTCTTCAATGTCGTTTCCATGATGATAAACT
TGAAAGTCTGGCGATCTAATGCCCACGCCTTCGAGTGCTGCACTGCTTTAACGGTTGCTGCTCGCGGAGCATTGTACATGAGGGCCAACTCGCCGAACGA
CATTGCTTCAGTGCACTGCATCAGAAGACAAAAAACATGAGCACCCTGCCACTGAAAAAAAGCAAGAACCCCTTCAGTAGTGAACCCACCGTCTGTACGA
GATCGCCGTCCTTGTAAACTTCACATACGCCGCTCTCCAGAATGTAAAAGTTATCTCCGTCGTCACCCTGCTTGATGATGGTGTCACCAGGCTCGAATTC
CTTGGGGAACATGGCGTCGAGCACAATTTCGTGCTGCTTCTCGTCCAGCGACTTGAACAAAATGTTCTCCACGACCATGCGACTGATGCCCTCCCGCTCC
TCTGTAGACTTGGGGTGCACCACGCGCTCAAACTGCCGCGCACTGCCACGTCACACCAAGTCAGTTTACCATCAGACAGGACAGCGCCACCTCATAACAA
ACTGCTCACCTCAGCGGGTCAATGGTTTCAGCGGACACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGCGGCGGCGCGCTGGCTGCGATCTCGCCCA
CGGCGTCTCCACCCTCATCCTCGTCCTCGCTCTCGGACTCGTCCGAATGATCTGCCAAGAAAATGCACATTAGATCTCCATTCTCTACCATTAGGTAGTG
TAACTGCCCACGACGCACACTGCACGTGGGGCGAGGCGGCTGGGTTGTCCTCCTTGGCCCCAGGCTTGCGGCGAGGTGTGGCCTCCTCCGGGTAGTTGGT
CTGCAGGTACTGGATGATGTGCAGGATGGGGTTCTCGGGCTTGGCCAGCAGCAGCGACTCGACGAGGTTGATGAAGAGCGTGTTGATGCCCTTCTTGTGC
AGGTAGTCCTGCAGCTCCTGTTGGACGCCCTCTGCGTCCGTCATGCTCCTGTGCGGCGAGTGTCCGTCTTGCGAGTGGCTAGCTGGATCCTTCCGTCTCG
GGCTTCTGCGTGGGCCTGAAAACTAAACTGAGCCTGGCGTCACGGGGCCTTCGCTCCAAAATGGAAGAAACCCCTGCAACAGACGCTGAACCCAAGCGAA
AGATCGCCCCTTGTCGTTGCTCTGCCTGTGTAGTGGCTCCCAGATTAGAACGGAGAGCGTTGGTTTCTGCTCTGCTGGTCTCTGGCTGTCGTGCACGTAT
TTGTAGTGGCACGCCCAAGGAGATTTAAATAGCCGCGCTTCTTCTGCTCGCGACGCTTGGTTGGCTGCAACTTTTGGCAAGGCCGTATCATCACCTGTCA
ATTTAGACAACGTATACCCGGCAGAAGGCGATAGTGATCGTTTTAAAAAGGCACCTCCCTTTCTAATATCTGGAATTTGTTATACCAGCAAATTTGCAGC
TACAACCAGCAATTTACCTCGCACGGGTAGTAAGAGTGCATATACTGCCGCGCAAAGGCTCACTGCTCACCCTAATTAGTCGAGCCTCGACTAATTACGG
AGTGATTTTTTTGGGGGGTCAAACGCTGCGAAGGTCAAGTCGTGCGCAACTCGTTTTTTTGTGTGGCCAAGTCTTGCGCAGCTCGTTTTAAGGTTAACTG
ATGATCGAACATTATCACGACAGGCAGGCAATTGTTTTTTTACCCAATCATTACCCAATGATATCAAACTGTTTATTGACGCTTCCCGTGCAAATTATTG
GCGTTATATATAAGTTGGAGTGAATCTTGACAATAGCGCAGCAC