Description :
From Genome Similarity Track
Location :
Scaffold_319:20282- 26982
Transcript NameFunction/comments
Phypl_g6915glycosyltransferase
Phypl_g6916hypothetical protein
Phypl_g6917hypothetical protein PHYSODRAFT_301791
Phypl_g6918hypothetical protein PHYSODRAFT_507209

Sequence
6700 bases(100 bases per row)
CGCCACCGCTCATGCACGCGCGCGCTTAGAGGGACCTACACGCACGGCGTGTCTTCAAGTTGTCCATGGTGTCATGGAGCCTCGTTTGTTTTGTACATAC
TTTTTTGCCTCAATACAGACTTTCGTGAAGTTTTACATTGGTTGATTGATCTCGCTGCTTACTTGTCGTGTGTGTTGTGAGCTACGACGTCTGCTGTCAA
CTGCAGCGTTTGCAGTGTTGCAGCCAGCTCTTTGCAtctcgaggacgacgcctCGACGCCGTCACTACGATTCCGCGGTCGTTTCCCGGCGCAGCTCCAC
ATGATCTCGGCCACTGGACATCGGAAGTCGGCGATCGTGGCTCGCGTTGGCACCGACCAAGATTCTCGTGGACTTGCGAGTACGCCTTACTCCCGTTGAC
AGTCGACTTTAACGGCAGCCCTCCGTGACCCTTCCACTGCGGCAGGAGCTTCCTCCAAGCTGCCATCAACTTTCTCCTCGTGACTTgagtcgtcgttctc
gttcgaACAGGAGTTTGGGCACATTCGAATCGCGTCCAAGTCGCTCGTCGAGTCTGAGAAGCTGTCACCAGCGTCGACCTCCTTTGTGTCCTTGGTGGCC
GGATCGACAGATACCTAGGCAGCATTCGGGCACGCTACGACGCCGTCGGCCCGCTCCTTCTTATCGCTCGACTCGGCACAGGCTGCTACTTGctccgcaa
gctgcagaccGAATGAACTCCTGGCAGTGGCGACAACAGGATGCGCGGTGGGGCTCTTCTTGACGAAGTAGTCTGCTTCGACAGCAAACGCTGGTTCGGA
AGGACGTAGGTCGGTCATGCGATGAGCTTTCAGCGCGCGCATGGGGCAGCACGGCACAAGCGACCATTGCCGGCCACGTCCGAGGAACACTCGCTTGTCC
CGGACCTGACACTTGGAGCAGACTGGCATGCCGCACACACGGCAGCTACGCAGACGCGCCCCCGAGAACAAGCCGCTCCCATCGCATTTGATGCACACGA
CGCAGAATGCTTTCTtcggcggcggaggcagTTGAGCCGCAGTTTCTTCGAGCGGGACTCTCGACGCGGTCCTCCGAGCCAACAGCGTGAGTTTCTTGGC
GTCTGCACAGTCCACGAGCTTCCGCAGCGCACCGATACACGCCGACGTCGTGCGCGAAGTCAGCAGCTTTGGGGACAACTCGCGTTCGCCCGACATGTCG
AAGATGCCGCGTGTCAAGACGTCCACGAAACCCGGAGTCGTCTCGCAGAAAATGCACGCGAGGAAAACTTTACCCCGGACGATGTTGCTCTGCTTGTGAT
CGAATGGAGGACACTCTGGCACGTCCACAGAGTGCAGCAGGAGATGGCCGTACCGCTTGCCACAGGGATCGACCTCAACGCCCGTGGCCTGCAGACAGCT
GACATCCCTCGGTGCTCCGAGCGGCCTCACAGCGCACAGCCACTTGAGACCGAAGTAGTGGAACGGGTCCTCAGTCATTGCCAGCTCCAAGTTGCGCTGG
ACCGCAGCGTCCGTCTTCCTCAGCAagaacgacagcgtcgtgcgggtctcctcgtccgtcgtaCCGGCGATGCCGTACAGGACGTCGTCAATGCTGCCAA
GGATGTTCCCGATAGCCACGACGCTAGGCTGTCCACTAGCAACATCCCCCGCCGCCTGATGGAAGTCTTCCTCTGAAGCAAGCTCCGCCCTCGAtcgtcc
tcgacgacgacgttggaagagctgcaggccgtCGAACGACCGCGTCGACTTCCAGTCTCGCGGATTCAGACTTGGCAGCCCGGTGGCGAGTCTCTCGTTG
CAGCACTTCTCGACCGACAGAGCTGCGTCCAGTCGTCGACGCACCAGGTCTTGATACTTCCGAGCCTGCTCCTTAGACACCTGCACGTCGGCCAAGTAGC
CCGTCGGGAGCGGGATCGTCACTTTGGTCCCGGCGATCGAGATCCGCGTGCCCGAAAACGATTCCTCCATTGTCCGCGAAATTCGAGACTGCTACTTGCA
CGTGcaaccagcgccaccagcagcagcaacggagcGTAGGGACGATGACActctcgtcgtgctggttAACGGGTACCGGCGTAATGACAAGGAGCAACGA
GATAACCTCGGCATTTCTTTTGCGCCGATACTCACGATATCCACCCACGCATTGCGTTCATCGCGGTACCTCGAGTTCCTCTACATGGCGGAAGTGGCTA
AGTAACGTGTCGGTCTCCTACTACGGGCTGACTCACGCCAATGTATGAGCCCTAGTGCTAGCGGTCCCCGCTTCGTTGTCTTGGCCGAAGCTCGAGTCCA
TGCTCGAGGACGCGGGGCTGTAGAAGACGTAGTACCTGTCGGCTTCGTCGGAGCTCGAGGTGAAGCGGAATCggtccgcgtcgtcgtcgctcagctcCAT
GATGCTGTCCTTGGACGAGTCCTCGACGCTCGCGGAGCTCTCGCCGTCGAAcggcgagctcgtcgtccggtTCAGGGACGAGTTGAGCTCTGCCAGCGAC
ACTAACGGGCCCGGTCGATGCTTCTTCCAGTCGTCGAACGCGGTGTTGCAGCCCTCCAtcgccgctggccgcgcgAACGGAGAACTGAGCAGTGTCGTGT
CTTCCTCGGACAACGGTAGCGAGTCCATGAAgtagtcgtccacgacggcgtaCTCGGGCTCGGCAGGCTGCATCCCCGTCATCTGCAGCGCTTCGTGGGT
GCAGTTCGGGCAGCAAACGCAGGGTGCGTGCGGCTTCTTGCTCCCCAGGAACACGCGCTTGCCTTTgacgcagcacttggagCAGACGGCGATGCCGCAG
ACCCGGCACCAGCGGAGCCGGAGACACGAGAGCACCCCCGTTCCACCGCGCCTGATGCACACGGAGCACAGTCCGTGCTTAGGGTGCTCCGCGTCGACGT
TCAACGCGTCGCGGTTCTTGCCGGAGACGGCGTTGTACCGTGCCAGCAACGTCAGCTTTTTCGCCTCCGCGCAGCTCACGGCCTTGGTGAGGCCGCCGAC
GAACGCCGCGGTGGCGTACGGCATGAGCGACGCGTACGGCATCGAAAGTCTCCGTAATGCGCCGGAAGTGTCGAAGACGCCGCGTAGCACGACGTCGATG
ACCCCGGGCGGGCGTCGCGTAACAagcacgagaagaagatcttGCCACGCCGGACCTTCGCCTGCGCGTGCTCGAACGGCGGGCACTCCGGCAGATCGAC
CGAGTGCAGCACAAGATAGCCGAACCTGTCGTCGttggcgtccttgtcgaCCCCCATCGCCGCGAGGAAGCAGGCGTCGCGCGGCTCGATGATCGGGGCC
GACGAGTTGTACAGCCACCTGAGTCCGAAGAAGTGCAGCGGGTCGTCCGGCGTGGCCAGCTCGAAGACGCGCAGCACCGCGGAATCCGTGCCGGCATCCA
GGAAGGACGTCACGGTCCGCATCTCCTCGTAGTTGGTGGAGGCGAGCCCATAGAGCAGGTTCTCCACGGTGCCGGCCATGCTGCCGGTCGCGACGATGCT
CGGCAGTCCGCCGGCGACCGCTTGTCTGGCCTCAGGGAAGTCCTCTTGCTGCGCGAcgtcctcgagcgagcgtcctcgccgcctccgtctGTAGATTTTC
AGCTCCTCGTACGACCGCACGTACTTCCAGTCTGCGGGCGGGAGGCACGGCAGCTTGTCGGCTTTCCGCTGCAGATagtgctgctcgtcgtccagcagcg
cgtcgagtctgcgctgcaccacgtcgcgATACGCGAGCTTCTGCGCGGCCGTGACCTGGATGTGGCCGAAGTGGTCTTTCGGCAGCGGGAAGCGCGTCAT
GGAGGCACGTTGCCAAGTGACCAGCACGGAGAGAAGGTGTGGGCCACGGCGCGAAAGACTTGGGCACCCTCGCAGGTCTTTCCAGCACGCTCGTCACACC
GCACCGGACAAGAACGCCCTGCGCTGATGTTGCGGTGTCAGCACGGCTTGGATTGACGACCCATCAAGGTATTGGCGCCGGAGTGATCACTCCTCGATCC
AAGCAGCCCGGCGCAGGTTAAAGACGGCAGTCACGTTGCGTACCAAGCGGGTGGAGGGCAATGGCGACACTCGCCAACGTTTGGGTGAGGAACGCCGACC
GCGAGGCGGGTGGTGGACTCAGGCAAAACTCACACACACGTCACACATTGATgcgaggctgcagctcgcttACGCCTACGTTATCCTTACATTCCTagcc
gccgacgctgcaTCTCGCGCATGACGGAGTCGTTCTGCTGCACTTGGCTGCCGATGGACGTGGCTCGCTCGAGCAGTTCAGCCAGGGCGTCCGACGCGGA
CTTGACGCCCACCTCGATGCCCTCTTCTTCGTACGGGGGCTCGCGCCACTGCTCGACTGTTTCGAGGGCGAGAgcgtagtcgtcgtcctcttcagcgctg
gagctgaaccCGTTCACGTCGCTCAACGTGGAGGCGTAGCCGCCCATGAAGTCGCGGCCGACCCagctctcgtccagcgtggcgtccGTGGGGCGCTCCC
CGGCAGAAGCCGATTCGTCTCGGACCACTTCCGGCACGGACGCGGTGTCCGTCTTGTCGTCGCCCCACCACTCGCTCGCGTCGATCTCGGAGGCGCTAAG
TGAGAccatgtgctgctgctgagctaTCGCGGCATCCAGCGCGCCGGAGTACGACTCGAGCGCTGGTCCGTGCAGGTAAAAAtccgccacgacggcgtaT
CCTGCGTCGCACGGCCGCATCCCAGCCATCTGCTGAGTCTCGAGCACGCAGTTCGGACAACACACCGCGAACGCGCACGGACGCTCGGACCCGAGGAACA
GCCGCTTGTTCTTGGCGGAGCACTTGGCGCAGATCGCCACGCCACACACGCGGCACGCGCGCAGACGGGTAGTCGAGAAcaagcgcttgctgcgcttgat
gCAGACGGAGCACACGGCGTCCTTGGCGAAGGACCCGCTCTGGCTGACTGCGTCCAGATTGAAGCCAGACACGGCGTTGTGGCGGGACAGGagcgtcagc
ttcttggctTCCGCGCAGTCCACGCCCTGGAGCATGCCGCCGATGAACGACATGGACACGAGCGGCACCGCGTGCCGCGGCAGGTCCCCGGACAGGTCGA
AGATGCCGCGTACCATGACATCTACGAAGCCCGGCGTGGTCTCGCGGAAGAGCCCGGCGAAATGCACCTCCCCACGGATGACGTCGTTCCTCCGGCGGTC
GAACGGCGGGCACTGCAGGAGATCCACCGAGTGCAGCACCGTGTAGCCGAAGCGCTGGCCGttggcgtcttcctccaccCCCGCCGCCTCTAGATAACAC
GCGTCGCGGGGCGTCGTGAGCGCCTGCATTggcatcttcttgagcaccCACTTGAGTCCGAGGAAGTGCAGCGGGTCGTTAGGCGCGTCGAGTTCCAGCA
CGCGTAGTAGCGCGCAGTCGGTCGGCTCGTGCATGTAGGCCATGGTCGTctgcgcctcgtcctgcGTCGAGCTGAAGCTACCATAGAGCAGGTCTTCAAG
CGAGCCGGGTACTCTGCCCAGCGCGATGATGCTGGGCTCTGGGGGGTGGCCACCTTTCACCTCGGGCTTCTGCTGtgcgcgtcttcgtcgtctgtACATT
TTGACTTCATGCTGCGACCGGACGAACTTCCACCCGGTCGGGTCAAGCCGCGGTTGGTGGCCCGCTTGGCGCGCCGCGTAGCGCTCTTCGTCAGCGAGTA
ACCCGTCGATCCGTCGACGTACCAGCGCCCGGTACTCGTCGGTTTGCTCCACGGAGACGTTCACCTGTCCGAAATGGTCTTTCGGGAGCGGGAATTTAGC
GCTAGAAGCGGCGGAAGCCCCTGAGTTCGAGTGACTCGACTgcatggcggcggagacgcGGCTGATGGTCGAACTGGAGCCTGGACGCGGTGCTTCCATG
cacagcaacgccaacgctTGGAACTGGGCAGCGACGGTCTCCGATCGCGGATTCCGGAAGATTGGGGATTAAGGGATGGTACTTCGACGTTGACGTCAGA
GGGCAGTTGTCTGACCATTATGAATGAGTCCAAGCGCAGGATGAGCAAGAAGAGAGACTCTACCGCTGTTAAAAAGGGTGTGGTAGTGTGCAGTGAAAAA
GTTTTATATACACCTCTTGAAACCTGGTACTCGTCTAAACGGATGACTCTAATGTTTTTCCTCGGATAACATGAATATACATAGTGGGTTGTGTATTTGG
ATACAACGCAGCACTTCATAGTATGTTGGGACGCAGTGTTTGTGTATTGCTAGAAAATATAGACACGCAGCGATCCTTGTGGGTATTCGTGAGGTTGCTG
ATCTTGCCATCTGCTGCTCGGACCGAGCCTGACGAGGCTGAGAGCGTGCCGCAAAGCCATCGACTCGGTCCCCAGCTCAAGTTTTCTATTGTAGACCACG
CCTGCAAACGAGAACGGCTGCGTAAGGTGCATTCAACGTtccttgcagcagcggcttcaagGTCCTTGTAGTCGTCTCAGACTCAGCGCAGTCTGACTGC
GGTCGAATCGACAGTGAGTTGAGACTTTCACCGACATCGACCAGGCCTAATACGTTGGGGTTGAATCTCCCATCAGCATGTACAGGCATCTGCGGGAAGG
CTCGAGCTCGTCACTTCAGTATCGGCCTTCCGTCTCGTCAACCGCCGACCCGTCGGCTTGggagcacttcaacgtgctcgGATCCTTTATTTAATAATTT