Description :
From Genome Similarity Track
Location :
Scaffold_22:202801- 204276
Transcript NameFunction/comments
Phyca_LT1534566653Amino Acid/Auxin Permease (AAAP) Family

Sequence
1475 bases(100 bases per row)
ccaacatggcggccttcttcacgctcgaggacgccaagatcagcttcagcatcatctgctgcatctgcggcatcgggacactcgccatgccgtccaattt
cgcccgtgctggacccgtgtacggcactatcgcgatgctcttcatggcgttcgccaacatttacgcgacggtggccttgtcacgcgtcatcctcgtggcg
ccgccgtccgtcaagacgttcggtgatgtcggcggctgggtgctcggtgctcccggtcgctacgccgtcatgatctcgcagttgctcgtgtgtctgctac
taccctgcgccttcctggttctaggtagtacactacttgacgtgctgttcccggacgccttcagtcagatcttctggatcattttcatggccatcacagc
cgtgccggcgtgtctgatcccgaccctcaaggccgccgcgaccgtcgccttcatcgggtgtatgggcacgatcatcgccgacgtggtgggcgtcagcgtc
ttggaatgggaaatgcgtggccacccggccgcgccgtcgccggatatctcgttgcaccaggtgctcacggcgttcggcaacttgtcgctagcgtacggcg
tcgccgtgctgatcccggacttacagcggcagcactcgcagccgaaacggatgccgcgcgtcatcgtggtgagtctcggcatcggttcggcctttttcct
ggccgtggctattgccggctacgtggctggtggctgccagctttcggctaatctgctcttctcgatcgtcaacattgcagacccgtcggcgccgtcggcg
ttggggttcgtgcccgaccacggcgcggtcatcatggcgtatctgttcatgcatctgcacgtcgtcattgttctgtcgacggtgcttcagccgccgttct
acatggccgaacgtctcatcctgggcatgcacaaggacgccgtggccatccaggccgaggacaacgacggatgggaggagattcgcgacaagatgtcgac
gaacgacccgagcgtcaacgcacgtgacctggagaacaacgccgactcggacacggagacgctgtcgaactcggccaagcgcgagcaggaggagaaggag
cacgacgacgcgcaactctcggactacagcggctcggccaacgtgttccgctacgtgacgttgcgtctggtcattatggccatcctggtcggcgccgcca
tcggcttccgcgaccatttcctggacctggtggactttacgggcgcgtcggccatcaccgtgtgctgcctggttctacctctcatcttctacctgaaggt
gttctggcgcgacttgcccatgtacgagcgtgtggtggcggccgtggtcatcgtggtctgcaccgtcgtgggctgctacgtgatgatctacgccggcaag
aaccttttcagcccggactcggacagcgccacgttcccgtactgctcggaggagttccagtcggagccgtactac