Description :
From Genome Similarity Track
Location :
Scaffold_235:2028- 3480
Sequence
1452 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAAAAAAGATGGAAGAAATACGAATTATGGGAGCGATCGAAGGGGATGAGAAGAAAGTATATTGAGAGATCGCGTCATGGAACAGACCAAGTAAATTA
CTCGCGGTCAAAGAACTTACCAACCAAGCGTGGAAGAGAAGACCCAGGTGGGATGCGATCGAAGGACGAAACTAGTTCCTCCAACGCTCGGTAGCGTGAT
CGATCGACAAGGCAGTGATCAATTTGGGTATGTTGGTCCGCCGCACGGATAGGCCGGGATACCACACCCTAGCCTCATTCGGACGGGGAAAGTGTAGAAA
TATGGGGTCCAGTAAAATGTCCAAATCGCAGAGGCCGTCGATCATGCCTTGAAGAATCAGCTGCAGTACCCGCTTCCAACGGGGGCCAGCACGAGGTTGT
CTCTGCCTTCTCGCTCGCGCAAAAGCAGCCAATCCAGGATCCGTTTTACGCTGCTCAGCGGAGATCCACAAGAAATGGGTCGATTCCGACAGAGCTTGGC
GATGGCTATCCACGAAATCTTCATACGCCTCGACCAGTTTTTCGAACCAGCCGGAAGGCTTGAAGGAGATCGGGTGTATGGTTTGATCATAAAGGTCCCA
AGGTTGTTGATCGTAAAATTGGTCAATCTTGGTCGACCTGATCAACTGGGATGACCAGGACGACTCCGGAGGGAGGCGAGCTTTGCCCAGTTCGACCGGG
AAGATCTATCCCTTGGTCTTCGAAAAGTGATGATAGAACAAGTCTATGTCCAGATCCGATACCCTGATCAGGCTCACTCTTCGGGCGAACCAAGGGGATA
CATCTACTGCCGATAGCGGAACCCGATCGCGATACCCCGGAATCCAAAGATCGCGGGGTATGTGGGTGTCAGGAAGTGCCGAAAACTCTTCAGGAGTCAG
CAGTGAATTACAGGGACTCCGAGAATCACCAGAGAGGCTGACGTCACCTTCA