Description :
From Genome Similarity Track
Location :
Scaffold_4:2027877- 2029082
Transcript NameFunction/comments
Physo_505636Pao retrotransposon peptidase family protein

Sequence
1205 bases(100 bases per row)
GATGATGTCACGCCTCATGCCGAACACATTCCAGAATTCCGGCGGGTACGTCTCCAACCAAGTCCGCTGAAAGTAGCTCCAAAACGTTCGCCACTTGCTG
CGAGAGTACTCCAGACCTTTCACCTCACACACGCTGCGAATCTTGGCCTTCACCCAAGCGATTCCCTGCACAGCAATTTTGGTGGGATCAATGACGGTAA
GTATGTCAAAGACATTACGCGACATAGCAACCTTGATTTCACCAACTGGTAGCCCAATGCTTTTCATCTTGCGACGGCATGCCTGTTTAAAATGAAACAG
GCACCCGATAATGGTGACGTCAGGAAAGAACTCGCGAAGTGCTCCAATCAGTGAACTCTCAAAGTCACACACCACATCTTTCGGAACCAGCTTGTTCCCC
ACAGCATCTTGTACACATTGCAGCAGTCGGACGTAGGATTTTCTCGTCATAGATGTAGTTGCCGCATGCAGGACAGGGAGAAACAGCTTGCTGGAAAGAT
CATAGATCATAATTGTGACACACTGCTTGTAGTCGACGGGGACACATCTAAACGTGCCGTCGATAAACCACGACAAGTTTTCGAAGCAGAGCAAATTCAA
AAGCGTAGGATGAGCCCACGCAGTTATCTGATCGATGCCATTTGCATCCTTTGGCGGCTTCTTCAGCGCCTTGACGTCATCGTGCCAGGCATACTGAAAC
TGGAAGAAGCCTTGGTGCAATCCTTTAATCTTGGTCAGTCGGGGGTTCGTCATGATACTGGCTCGGCCGTGACTGGAATCGTGGCCCCAAGCTTCTTGCA
CACGGTTTTTGACGGTTTTCTCCGATACGCTGCGAACCGGAGCCCCATCGTTCATGTAGAACTTGTCCGCAATAGCCATCCATATTTGCCTCTGAGTGAG
AGTCGTTTGAGTAGCAAGTTTGTCGACCTCCTCCATGATGTCGTTCGAAGCATCTATGGCGTGATCGCCTAGGTTCACCGTTGCTCCTCGGAGAGCAGGA
CCAGCACGGCATGTATGAGCCTCCATGCTGCTGAAGTCAAACGCCATCGTACTCGCGTAGAATGCAAATTGCGCAGGACAGGGGGAACGATATGAGCTGC
AGCGATACGATATCTTGTTTGAAGTTCCGTTAGCTCGAACAAAAGAGTATCCCTGATAGTACAGTTTTGTACGTCCGTCCCGAGGCTTGGACGCTTGTTG
CGAAC