Description :
From Genome Similarity Track
Location :
Scaffold_208:20278- 21692
Transcript NameFunction/comments
g11480.t1hypothetical protein

Sequence
1414 bases(100 bases per row)
AAAGTGATGAGACTTTGTGTCCCGAAATCGCAGCGCAATCATCTAAGGACGAAGATTATTGAGCAATTTCATGATTCCAGTATTGCCGCGCACCCAGGAA
TTCGTCGTACGTACCTCCGTATCAAGCAATGGTACTACTGGGCGTCGCTTCATGAAGACGTTTCTGATTACGTGCAAAGTTGTGAAACATGCACACGTTG
GAAGCACAGCAACGCCAAGAAGAATGGCAAGCTGATTCCAATTCCGATTCCTAAGGAATGTTGGGAAGTCGTCTCCATGGATTTCGTTACTGGATTGCCA
GAATCAGATGGCTATGATGCTATCATGACCATCGTGGACAAGTTATCCAAGCGTCCGATCTACTGTCCCGTTCACACTACCGATGATGCCAAAGAAATCG
CTCATTATTTCTTCGACAACGTCGTTCGGCATCATGGAGTGCCTGCAGTGGTAATCAGTGATCGTGATCCCAAATTCACATCGCGATTTTGGAAATCTCT
CGCGCAGGTCATGGGTATACAATTGAATATGACAACGTCGTACCGCGCTCAAGCTGACGGCCAAACTGAACGTCAAAACCTGGTACTAGAAGACGCACTT
CGTTGCATGGTCTCGTATCATGGTGATGACTGGGCTGCCAAGTTGGGGACGATTGAGTATGCTCATGCCACGCTAGTCAGTGCCTCTACAGGACGTTCGC
CATTTGAAGTAGACACAGGGCGTAAGGAACGCAATCCCTTCGGAACTTTTCCTACGCTGTCTACCACAGTTCAAGTACAACAAGGACTGTCTGAGTATGC
AAACCGCTTCAAGGATGAACGTGACAAGATTATTGTCAAAGCCAAGGAGCACCTACTCAAGGCTCAAGCATCGCAAAAGAAGTACTACGATCAACACCGT
AGCAATGTGCAATTCAAGGAAGGAGATTTGGTTATGCTGGATACACGCCGTATTCCACTCAAGCATGCTGCGAAAGTCATTGACGTCAAACGTGCAAAGT
TAGCCGCTCGAAAAGTTGGTCCGTTCGTTATCAAGCGCATGATCAACGACAACGCTGCTCGTCTGATTTTGCCACGCAGTATGAAGTCGCTGAACCCTAC
TTTCAACGTAGACGTTCTCAGCCATTACGTCTCCAACCCGGACAAGTTTGAGACTCGTGTTCTTCTGAAAGCATCTCGCATCATCACGAATGAAGACACT
GGAGAAGACCTCCACATTATCGAGAAACTTCTACGCAAGCGCCAGTTCAATCGCAAGACTGAGTGGCTTGTCAAGTGGCATGGTCTCCCAGACCACGAAT
CTTCGTGGGAACTCGAGAAAGACATCAAGCACGTCTCTCACTGGAAAGTTCTCGTCGACGACTTCAAGCGCCGTCAACGCGAAGTCAAACCCGGGAGGAT
GTAAGGATCGAGAC