Description :
From Genome Similarity Track
Location :
Scaffold_7:202738- 204006
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003442Similar to HDT1: Histone deacetylase HDT1 (Zea mays)

Sequence
1268 bases(100 bases per row)
GCTCCTTGCTGAACTTCTCGATCGGATTGTTCGTCTTCGCGACAGTGTCGGGGCTCACGCCATGGACGTTCCACATGGCTGGAGGGTGCACATGTCCAAG
GTACGTTCTCCGAAAGTACTTCCAGAACATCTTCCAGTTTTCCGTCTGATACTCGATCTTGAGCTCGCTGCATCTCGCTTTGATCTCGCGCTTGACCCAC
GCGATGCCCTGCGCCTTGACTTTGGCGGGGTCAATGACCGTGAGCGCATCGAGCACGCCCGGCTCTATTGCCACGGACGCGGCCAGGTCGGTGATGCCTA
GTTTCTTCATTCTGCGGCGCACAGCGTGCTTGAAGAAAAACAAATTCCCAGTCACCTTCGCACTTGGGAATTTCGCTTTCGCGGCTGTATGTAGCCCAGA
TCCGAAATCGCACACGATTTCGGCGGGGTCGATCGCACGGTCCGTCGCCTGCACGATCAAATGCAGCACATTTCGGTAGAGATCGGCCGTGCGGGACGTG
CACAGCACGTAAAACACTGGCACGTGTAGTCCAGAGCCGCGGTCGTGGACCATGAGCACGAGGCACTGCTTGAACGTACGCGGCACCGATCTCCGGAACG
TCGTGTCAATGAACAGCGTCGTGCCGTGGTACTTGAGCAGGTAGATCAGGACCGGATGCGCCCACCCAATGACGCGTTCTGGCGACTGCTTCCAGTTCAC
GGACCTGCTCAGCTGGAACTGGAAAAAGTGAAGCTGTGGTTGGTCTTTGACTCGCGACAACGGCGGCATCTCCAATTGGCAAAGCATACTAGTAGTCATT
GCAGCAGCGCCCGTCCCAGCACCAGCAGTTGCGCTCGAAGCACCCGCGCCACTGCTTTCACCACCGGAAAAGTGCAGTTTGCGCGTCCGATACACTCGAC
TGATGACCTGTTGCCGCGTCAGACCCTGCGTGACGACGTCATCGCCCCTGCGGCTGGCGTAGAACTGGGCGTCGATGGCATCCCAGACAGCGTGCGCCGT
CAGCGACGTGTCGTTGATCGCCAGCGTGTCGACCGCGCGCTTCATCTCCTTCTCCACGTTCACCGTCGTCGTCGAGACCACGACGTGGTCGTCCTGGCAG
GTGTGCGGGTGGAAGTTGACGTACCCCTTGGCACTGAACGAAAAGTCGACCTTGCCCTTGCAGCTCGTGCGGCGGTACTGGCTGCACCGGTACGCGATTT
TGCGCTGCGATGCGTACGCCTTCGTGTACTGGTAGCCCTGAAGGTGCATCGTCGTCGAGCCGCTGCGC