Description :
From Genome Similarity Track
Location :
Scaffold_35:202731- 204308
Transcript NameFunction/comments
Phyca_LT1534535379Hypothetical protein

Sequence
1577 bases(100 bases per row)
cgaccgtggatctgttcaggtagcagctgatagcgatcaacaggaagcggctcagagccggcagaagatgaaccctcttgagtccacgcagcttccagtt
ccttttggtgcgctagctcttgactgtcctcttcttgctcatgttgatgggtatcagagaactccttcagcagacatttcatgttcaaagggtgaagaac
cacgtatgtcccgtcagcaagctggtagaacgagtacaagtccccactgttgtcatctcgaggcttccccttcttacctgcaacattggctatgttgctg
tggtttgcaccgtacgtgccgtgggtaaagtcgtcactcttggcaagccgtccggaagtgttccgcatggcctcttctacgaacggaaggttgtctacat
cgccgctgctacggaactcagcgtccattgactggagatcgcgcatttcagagtacaaaagctctcgcaaatatccaggcgttgcctccaagatacgaga
atacgtcgcgtcggcgtccgtcacgttcggcaacttccgagagcgcttccgtgcagcaaacgcgatagcctcgggggacgactgcgtggaattcgaagaa
gcttcagttgcattgcgctcgaccttgatatctaggggcggaagcacgcgtaactgcgggaacatactcgacttagggcgctccaggaattggaaagtta
cgtcggagcccacatgaggagggatttgcagttgatggagctgcacacttcgtagatggcccttttgaacggattcaaagcacatcggacaacgacgcca
gtatttgtccgtcatcgacagataccggagaatacacggccagctatattgacaataaatcggataaatagttagtctattgcaatgcacatactcgtga
atttagttacgcaccaaaagacgtgaccacatttggtgattttcggtgcgcggaaagtgtccatgcagatcggacaggtttgcgggctttcgatatcgta
ccacagcaaaacctgttcaaccgaagaccctgcaaaagccacgattaccgtaagatattgtataaactaaagttcttccatcgtatcttacattcagtga
gagcttcaagatcccaagtcggaacgactgcgtctgggtcaagcggtgcgatcacaaagcggtagctaatagacacaaatcaccatcaatcagtaacaaa
acattcatacgcggcaagctaccagcagacgtacttggcatggaggtactcgatctgagtgcgaggagcggaacttttcttcttcttctggtgatgatac
acggtcttctcacgctctggcatggagaagttaaggaggtggttagccgataccccatttcgagtggcgcgtgcctcgtaatccattgtcttcttctgtt
agatacagaagtattagggatcgaaaaaccgcatccagtcaataactgttctcacctgctctcggcgtggaccacgacggccggagccaccgttactgtt
attgcggctgctattattcctgttagtaaccacgaaaaaacgtcagtatttgtagtagatctcgatcaagcctcaga