Description :
From Genome Similarity Track
Location :
contig_5:20273- 23226
Transcript NameFunction/comments
g1296.t1atp-dependent protease subunit
g1297.t1cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
2953 bases(100 bases per row)
CACGCTGACGGGCAACGGAGACGTGCTGGAGCCGCACGACGGCATCATAGGCATTGGCTCGGGAGGCACCTACGCTCTCGGTACGTGCAGCCTGGTGTTT
AGTGAGCTTTTTATTGTTATTTTTGTGGAGATGATTGACAGCGCTGTGTTGGACGTTGTAGCCGCTGCCCGTGCGCTTATCGACCAGGACCTGGACGCCG
AGACCATCGCTCGCAAGTCCATGAAGATTGCCGCCGACATTTGCGTCTACACGAACGAGAATGTTACTGTGGAGATGCTGGGGAGGGGGAGTCTGAGGCC
AAGACTGACAACAAAGAGTAAGATGAGGTAGAACAGGTTGCACGAGGCGTGTAATTCGTCAGCAACGCTCGAGTAAATACAAGGTCTGAGCTGTTGAGTT
GAATCGCCTAACCATTGCAAGCAGAACGTAACCAAGGCACAATGGCGTGTCTGAAAAATATGAATATGATAGTCGTGGTCGGGCAAAGGAAGACAAAGAG
AACGCTAACAAACGTCACCGAAATGACTGCCATCGCCGTCTGCCCCGTGAATGCAACGCCAGCATCTCGGTTGTCAGTCACAGTCCACAGTAGTGTGGCA
CGCGAGGTGCCAGATGTCCTTCGTCCCTCGTCCCTCGGAAATTGTGATGGTTGAAGGCGTGTATAAGATGTAGTATTGGTGCGCGTGTGCGTTTTCCTTT
TCCTGATGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGAATGTCTTCTAGCGGGCCCATAACTCTCTTGAACGTT
TTACGGTCCAACGTGAGACACTTAACCTTGCCCTGGGCGGTCACTGTTGCCTGACGAGGCCGAGTTGTGAGCAGTGCGATTTCACCAAAGTACGCGCCGG
ATGTGAGCTGGCCCATTTCCACTGGCGGGTCTGCGGGCGAGAGCTGCTTCGTGCACACTGCCGAGCCTTCCTCAATAATGTAAAACAGGTTGCCGTCGTC
ACCCTGTGCGATGATGACTTCGCCATCACTAAACGTTTCTGTCTTCAGAGCGTCTGCGACTGTGAGACGCTCGTACTCGCTGAGCGACTCGAGCAGTGGT
ACACGCTCAATGAAGCCCTTGTGGGCCTCGCGTTTCTTCAATGTCGTTTCCATGATGATAAACTTGAAAGTCTGGCGATCTAATGCCCACGCCTTCGAGT
GCTGCACTGCTTTAACGGTTGCTGCTCGCGGAGCATTGTACATGAGGGCCAACTCGCCGAACGACATTGCTTCAGTGCACTGCATCAGAAGACAAAAAAC
ATGAGCACCCTGCCACTGAAAAAAAGCAAGAACCCCTTCAGTAGTGAACCCACCGTCTGTACGAGATCGCCGTCCTTGTAAACTTCACATACGCCGCTCT
CCAGAATGTAAAAGTTATCTCCGTCGTCACCCTGCTTGATGATGGTGTCACCAGGCTCGAATTCCTTGGGGAACATGGCGTCGAGCACAATTTCGTGCTG
CTTCTCGTCCAGCGACTTGAACAAAATGTTCTCCACGACCATGCGACTGATGCCCTCCCGCTCCTCTGTAGACTTGGGGTGCACCACGCGCTCAAACTGC
CGCGCACTGCCACGTCACACCAAGTCAGTTTACCATCAGACAGGACAGCGCCACCTCATAACAAACTGCTCACCTCAGCGGGTCAATGGTTTCAGCGGAC
ACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGCGGCGGCGCGCTGGCTGCGATCTCGCCCACGGCGTCTCCACCCTCATCCTCGTCCTCGCTCTCGG
ACTCGTCCGAATGATCTGCCAAGAAAATGCACATTAGATCTCCATTCTCTACCATTAGGTAGTGTAACTGCCCACGACGCACACTGCACGTGGGGCGAGG
CGGCTGGGTTGTCCTCCTTGGCCCCAGGCTTGCGGCGAGGTGTGGCCTCCTCCGGGTAGTTGGTCTGCAGGTACTGGATGATGTGCAGGATGGGGTTCTC
GGGCTTGGCCAGCAGCAGCGACTCGACGAGGTTGATGAAGAGCGTGTTGATGCCCTTCTTGTGCAGGTAGTCCTGCAGCTCCTGTTGGACGCCCTCTGCG
TCCGTCATGCTCCTGTGCGGCGAGTGTCGTCTTGCGAGTGGCTAGCTGGATCCTTCCGTCTCGGGCTTCTGCGTGGGCCTGAAAACTAAACTGAGCCTGG
CGTCACGGGGCCTTCGCTCCAAAATGGAAGAAACCCCTGCAACAGACGCTGAACCCAAGCGAAAGATCGCCCCTTGTCGTTGCTCTGCCTGTGTAGTGGC
TCCCAGATTAGAACGGAGAGCGTTGGTTTCTGCTCTGCTGGTCTCTGGCTGTCGTGCACGTATTTGTAGTGGCACGCCCAAGGAGATTTAAATAGCCGCG
CTTCTTCTGCTCGCGACGCTTGGTTGGCTGCAACTTTTGGCAAGGCCGTATCATCACCTGTCAATTTAGACAACGTATACCCGGCAGAAGGCGATAGTGA
TCGTTTTAAAAAGGCACCTCCCTTTCTAATATCTGGAATTTGTTATACCAGCAAATTTGCAGCTACAACCAGCAATTTACCTCGCACGGGTAGTAAGAGT
GCATATACTGCCGCGCAAAGGCTCACTGCTCACCCTAATTAGTCGAGCCTCGACTAATTACGGAGTGATTTTTTGGGGGGTCAAACGCTGCGAAGGTCAA
GTCGTGCGCAACTCGTTTTTTTGTGTGGCCAAGTCTTGCGCAGCTCGTTTTAAGGTTAACTGATGATCGAACATTATCACGACAGGCAGGCAATTGTTTT
TTTACCCAATCATTACCCAATGATATCAAACTGTTTATTGACGCTTCCCGTGCAAATTATTGGCGTTATATATAAGTTGGAGTGAATCTTGACAATAGCG
CAGCACAGTGTAGTCTTTTCAAATCATCACGACTCGACACCAAGCTCCACTCC