Description :
From Genome Similarity Track
Location :
Scaffold_340:20267- 22536
Transcript NameFunction/comments
Phyta_totarag7310conserved hypothetical protein

Sequence
2269 bases(100 bases per row)
AAACTCGCCCCAACGAGGAGTGCACAAGGTAGCTAACCGTACAGAAACGACTGATACCTTCTCTCCACGTATGTTGGCGTCAATCCAgggcagaagctga
agccctCTACGACTCACAACCTTTGTGGCTCATAACGCTAATTTAGATATCACTAAGTCCTTTACAGTGCGCAAGCTAATGGTACTATGAAGACCCATTT
CAAGTTCATTTGTACTTTAAACAACAATTAATTAAAGGCGTGGTCAAACAGTCAAGAGAAGCCCTACTACTAACGCATTACCAAACAAAAGTATCACTTA
CTTCGGAACTGCGATTCAAGCGGGTCCCACCGCCCGCGAACCAATATTCGTCTTACAATCAATCCCTGCTCGTAACCAAACTAACCAGTTTTCGGCTAAC
CGTTTGCAACTTGATTAGGTCACTGTGAAAGGACCGgcagacagcaacaacctCGCTATTATCCTCAACACAACCGAGAACAAGACAGCGGCAGCTCACT
TCAGGAGTGTAAACTTTGAGGATGGATCGAATGAGGAGCACAAGGGTAATTGACATCGTTTAACTTTGCTTTTTGTCACGTCAATGGTGTCACTATCGAG
GGTTCCCCACTGCCGCTGACTATTTCACTCGGTGGCAACTCGGTAATTACTACGGATCACGTTGTCAGAATTTTCTGCTTTCCATTCTACCAAATgaagt
ggtggtgatcgGCCTCATCTCCTTGGTCCACCTTGTTGTCATCCTCCGCGTGCTTGCTGTGTCGAGCAGGCTGCGATCGCCACATAACTTGTCTCccctt
gcgcttcttgggtGCCTGCATACTTCTCTCCATGGACTTCTTCATGCGCTCTTCGTAcattttctgctgctgtgcaatTCGTTCCTGTCGAACCCGTTCA
CGACGCTCTTTTTCCTTTTCCTTCTCAGCCTTTGCCACATAGTCCTCAGGCATCTGCTCAATTGCGCTCAGTAGATCTTCCAGTCGAGCCTCCAGGTCCG
TGAGCATGTACAACGTCGACGAGTTGGTCTCAGCTTCGAAGCCACAACGTTTGTACACTTCCAGCACTCGGTCCTGCAACTCCTTCAGCATCCGTTCCTG
TGCATTCTCGCCGGTGCCACCTTGGGAGCGCAATCGTAATTGACTGGCCTTACCTTCCTCTGTACTGATCTGTTGCTGTAAGCCGTCAACGTTGGTCTTG
AGTGCCTGCGTTTTGCGATCCATGGTTTTCTTCGTCTCGCGGTAGTTTTGTTTGAGCTCCTCTAGTGTTTGCTCAGTCTCCTGGCTGTTCTGGATCAAGA
AGAGGTTGCTCTCTTCCAGCGCGGTGAAGATGTCAAGTAGTTGCTGTGGGTTCTGGAAGTACATAGAGATCTcttcgccactgctggtAAGGGGCATGCT
GTCTAGGTTCGGCATTGGTGGCACGATGATCTCCTTCACTTTCACCACTTTGTCGGGTTTCTTTTTGCCGTTTTTCGACTCAGGGCGTTCCTTCTCCGCA
CGCTCGCGCTCTTCGATCTCAGCCAGAGCTTTGGACTTCTGCAGTTCCCATTCGCGCAGGATCTTGTCCTTACGCTTTTGTAGGCGAGCCATTTGTCGAG
CCCGTTTCTTGTCGCGCTGCTCGATTTCGTATTCTTGAGGCGTAAGCTCGTCTAGGAAGGCCTTGTACTGGAGACAgtcttgaagctgctcactCAACTT
GGACATGTCACTCTGCACGAGTTGGATCTGCTGGTTCAGCTTTTTTATCTCTTGCACCTTGTCTGCTTTGgccttcgtctccttctccgcgCGCTTGATT
GCCTCGTGCGCTTTCTTGTCGTTCTCCTTCAAGAACGTATCGAAGCGtacggcgtcttcttcgagcaTGAGTTCACTCTTTTTTAGCgcttcctccttca
gctgagccttctcctcgagcttTCGGATTTCTTCACGCTTCGTATCGAGCGACATCTGCACGAGGAACATCTCTCGCTTCTTCGCGATAAAGTCGGCCAT
ATTTTCCTTTTCACGGAGTCGATCATTAGAAATTGTagccgtcgctgcagcaacgagacCTCGCGTTTGATGCGACTGAGACTCCGAGTAGTTATCTAAC
CCAGTCGGCTagaaacaacaacaaaaaacgAGTCAGACAGGAAGATAAAGTCCATGAATGCTGTTTTGGTCGCCGCCTCACCGCGTCATCTGAGCGGAAG
CGGCGAATATTGCCGATCTTGGACGAGGCCGTGGTCTTATCGTAGATTTTGAGTCGTGAATTCCTGTTC