Description :
From Genome Similarity Track
Location :
Scaffold_379:20266- 21940
Transcript NameFunction/comments
Phyta_totarag7756transmembrane protein, putative

Sequence
1674 bases(100 bases per row)
CCCAACGCGAGTCAAACCTGTCGACGCCTCGGCTCAGCAAGAAGttgcaagttgaagatggcgcCGACTATCTCGAGGCCAAGTCGCCCAACCCAATGGC
CAAGttcgaagaaggcgctctGCGTGACGGCCCGCCCCCCGAttcgaagagcaagacgtACTTCGGCTTCCTGTTCCAGTACGCCGGAGCTGGACTGATC
TACAGCGTGCTCTACAGTCTCACGTACCCGTTCCTGAACAACTACCTTCGCATGTCCGGCATCGCTACTGCCTCGGCTAGCGTGTTGATTGCGCTTCCCT
GGTCGCTCAAGACCTTCTTCGGTATCATCACAGATTGCTACCCGATCTTCGGCTACCGTCGTCGCCCGTACATGGTCATCGGCTGGTTCGTGTGCACGGT
CTGCTCCTTCGTGATGGCTGTGATTCCCGAGGGAGACCCGTACTACCCGGACAATTCGTGGGCGTCTCTGTCGGAATCGGAGCTCACTGCTGAGCAAATT
GCCGAGATCAACTACGACGCCCCAGACGCCGGCACCAAGTTCATCCTGCTCATGATTGTCGCTAACCTGGGCATGGTCTTGTCCTTCACTGCTTGCGGAG
GCACACTCGTAGAGCTGTCGCAGCGTGAGGGCGAAAAGAGGCGTGGTGACTTGCAGACGATGATCTGGGTCGCTCGCGACGCTGGTGGTGTCGTGGCTTC
AGCCCTTGTTGGCTTTGGTCTCAACTCCGAAGAGTACGGTGGCACCTTTGCGGGATCGATCCGTGTGGGAGGCCTCATGGGTGTTTGCACTGCCACTTCG
TTCGTCACCGGCCTTGTGGCTTGGTACTGCATTGATGAGGAGCGCGTGGAACGGCGCTCGATGAGGACGGAGATCAGCAAGTTGTTCGACTTGATCCAGT
ACCGCGTTGTGTACCAAGTGCTGGCCTACCAGTTTTTCGGCAACATGTTCGCATACGTGAGTGTGACCGCTGCGACTCCGCTGCAGAGCGTTTGGTTGAC
CATTTCTCCTGTCAACAGCAATGTCGCCACCATCATATCGACCTTTATCtccatggcgtcgctgctaGCAGTTCGTCAGTGGGGACTGAACTGGAACTGG
CGCTGGATGATTGTGATCACGGAGCTCGCTGTTGTGTTCGTGGACTGCTTCCCGACCTGTTTGACGATTTGGGACGTCGTTCGCTCTCAATGGTTCTGGC
TGGGCGTGCCGCTTCTGGAACAGGTGCCGACCAACATTGGATTCATTGTCTCGACTTACTGCATGGTCGAAATCATGGAGGAGGGCAACGAAGCTGCCTT
CTACGGTCTTGTGGTTGCCGTCTCGAGTCTTGCGTCGCCGTTCGCCACGGTCATCACCAAGAACATCGATGCCAACTTCGACATCGCCACGGCTGATCTC
CAGCGTGACGACACCGCAGTGCGGCAACAGGTCACCTATGCTTACCTCTGCTCGTACGCGTGTAAGATCTTCTCGAcggtcttcgtgctgctcatTCCGC
GTCAAAAGGCAGAGACCCAGGAGATGCGGCGCACGGGTGGCAAGAGCAAACTCGTGGGAGTCATCGTGGTGATCATCATTGCCTTCACGTACGTCTGGAC
CATCATGACCAACATCATGTCCATCTTCCCAAGCACCTCCTGCTACAAGATTGCGGGAGGAGACGGCTGCTAAT