Description :
From Genome Similarity Track
Location :
Scaffold_548:20264- 23587
Sequence
3323 bases(100 bases per row)
AACCCCGTTACACCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAAAGCGCGTCAATCGAGTGCTCGAGG
ACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAACTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGG
GTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTATAAGTGGGGGAGAGGCTCGG
AAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGAAAACAGGTGGAATCCTTTATGGATACCAAGCTGTGCATTGTCAGCAGGGTCC
GCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGTGGAAAATTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCT
AGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCAGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGT
GCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACT
CGCAGAACCCCCTTGACCCAGGCCCTTGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGACGTCAGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGG
ATGTGGTCAAGACCGTACGCCGGAGGGGCTGCATACAAACGGACCCCGGCGCCATATGCCGAGTACGCGGAGTACGCCGGGTACGTACCATACGCGTACG
TCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCG
ATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAACATGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCA
TTACCGCTAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCAC
TCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTTGTACGAGGGCACCTCCGCCCCTGCTTGACAGGAATGGAGAAGTCCACTTCCACGTGG
AGCGGACCCTCCAGGAGCAACGGTGTCGCAGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGATATGCCCTCCCCGAGAACTCGTGGGAGCCGATTGAACG
GCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTGTTGCCCGAACGGGGTACGGACG
ATGAATACATTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCT
CACACGCAGATCACGCTGGTCCAGGATGCGGGACAGCAGTTAATCTTCATGGCGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCCCCACCCATGCC
CAGAACATGTCCTCACAAGAACGCCACGTGGGACAGTTCTCCGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACACCGGGTCTCGGGCTTGT
TACGACAAGTCGTGAAGTACTTAAGGGGAATGCGGTGTGGCGCGAAAAGCACACACCGATCAGCCTCCAAGTTGTCAACGAACAACTGTTCTTTCTGAAC
AAGGGCTCGTTCATAGAAGTGTGCCCCCCCACAAGGCCACAAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGTCCCAGAGCTCTCCTCGGGAGGCCAAT
ACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGTGCCGCCACCGAACCCCACGCACACACTGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAAGTC
AATCGAGACTCCCGGAGCTCAACAATGGCACCCTCTTCTTCCTCCTTCTCCTCCTCTTTCATCCGAGAGACCGAAGAGACTCTGATAGGAGCGTCGAGTC
TCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAA
GCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGG
ACTGTGATCACCGTGATCACTAGCAGGGGACTGCACGCTACCTACTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCC
TGAGTGCTCTCGGACTCGGCATCGTCTTCACTGCCCGAGTTGAACACGCGTTCTACGAACCGAGGGTTCGGACGGTTGTCTGAAGACGAGGGCGACGGAC
TGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCC
GTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGTAGTGCCACGAGGCATGTTAACGGTCGAA
GTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACT
TTGAGAATGAGAATTTGTGACGAGCACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTTAGTGGGGGAGGGTGTAACGGGGTACGTAGCCCTCAGTGT
ACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAACGTCGTTCAAAGCCAACCA
TTGGTTAAATGACATTGCATTTCTATAGGTAACTAATAGTTTGTATTAAACACGAACTTATCCTACCTATAAATATACTCAGTTTACAATCTACCTTATT
TAGGTCACGTCGCTCTCTTTAATAAAAGAGGAGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTG
CTGTGTGACCCCGTCACACTTAA