Description :
From Genome Similarity Track
Location :
Scaffold_518:2026- 6778
Sequence
4752 bases(100 bases per row)
GGAACCCATGCTCGACCGTCGTGTTGCGTGACGGGAACCCATGCTCGACCGTCGTGTTGCGTGACGGGAACCCATGCTCGACCGCCGTGTTACGTGGCGG
GAACCCATGCTCGACCGCCTGCTTGGATTGCGGGAGCCCCTGCTCTACCGCCAAAGTGTTAACAACCTCGCTTCGCAGCGAGGGGTTCTCGCGCAACAGC
GCTGTGCAAGACATACAGAGAGGGCCATCGCTCGCTCTCAGCTCAACCTGCATTGTGGACAACCGGTCCACAACCCTGACATGGAGCCAGTCTTTCTGGG
CAACCAGGAGGTGCGTGAACACCTCACTCACATCGAAGCCAGAGCGGTGTTTAACCGACCGAGCCAACCAGTCAATCTCTGGTTGATATCGTGACAACCA
CGGGATACCCAAGATGCAGTCGAACGCGTAGTTCATCTCAATCACGAGGAAGTCGTCGTTGCTGCGGAAGCCGTCGAATGTGTATGGCAACGTGATCTCG
CGCCGCGCAACGCGGCGTGGCTTTCCGTCTGCAAGTTTGACGACGACCTGACCTCGACCATTACGGACTGCGATCTCTCTTGGAAGCATCGATAAGCACG
ATTCGCGAAAGAAGTTATTCGATGCTCCTGAGTCCAGGAGTGCGCGAAGTGGTCGCCGGGCGCCGGCGACATGAAGACTGACGATGATCAGCCTCGAGTC
GCCCGACGTGGTGGTGGCATTAAAGTAAGCGTGGAGCACAGGAGGGCTAGAAGGTTGGGTAGCCACCGGGGGGCCCGGACCTCCATTCCAGCCAGTAGGG
CCCCGCACCTACTGACCCTGACCATTTTTTGACTGAACGGCAGGTGAGACTTCAGCGGTGTGCGCGAGTACCGGCGCTGGCGCGCGGCATTCCGCCGCGC
GATGACCGATCTTCCGGCAGCGGAAGCAAGTGAGGGGCGATTGGGACGGCCGTTGGGCCCACGAGAAGTCGACTGACGATGATTATTTGATGCGTCAATC
GCGTCGATCTCCATGGGCTCGGGGGCTGACTCACGAGCTGCCGTTGACATCGCGCGCGCGTAAGACGCCGCCACATCGTAGTCTTCGCGTAACGCGAGGG
CGAATGCTTCCTCGAGAGAGGAAGGTTCCGCTCGGGTCAGGCGGTACCGTGTCATGCCTTCACGCATGCCGAATACGAATACATGGACCTGCGATGCTGC
GTCAATCGGATTTGTCACGATGCATGACGCGAGGTGGCGAGTCTTTTGAACGTAGTCGCGCATAGTCATTTTGCCTTGACGAAGGGCGAGGAACTCGGCA
CGCACGCGGGATTCGTCTTGAGGTGGCTCGACCGCGAGCCTGAGATCTTTCTGGAGAGACCCCAGAGTGGGGAATGCGTCGTGATCAACGACAAGTTTAC
CGAGGGCCCATTCATTGGCCTTCCCGGACAACCGGGACAATAAGAAATTGACCTTTGTCCCTTGCGCTTCGATCATTCTCGAAGCAATCGCGATGTCGAC
CTCGCGAAACCACCGGTTCAGCGGGAGGCGATTCGCTCCTTCACCGGAGTAGGTAGACGTCTCTAGCTTCACGACATCATTTTTCGAGGAACGCGCGAGA
GTTGTTGCTCGCCGATTCGCATCGGCTAGCTCGCGTTCCATGAACACTTGGGCTGCTTGGCGTTGTTGGTCGGACGTCGCTGAGCTCAGCAGCGACGCGA
TTACAGCCTCACCAGACACCGCCGCGAGGCGGTGAAGGGCTTCCCACTCGACACGAGTGAGATGAGGGAAAGCAGCATGTTCCAGAGTCGGCCCTGGAGT
TTCAGACGTCATACCTTGGCTCATCGTGAACTTGGTCATAGGAAGGACTACAAAGTGCTACCAGGTGTAACGGGCCTGGGGTGTCCGTTACTTGCTTACA
CGTAGTGATGAGGAAGCGTACAAGTCCAGTGATACTGAAATCAAGTACTTAGTCTGAAGGAAAATCAACTCTGTTTTTATTTAGGTCCAGGCCGGCTTGC
CCTGACCACTCAAATACACGTCAACTTCTTATTGGTTGATTATGGGTCTGGCTCCCTATATTTCAACCAATAGGGTGACGGCAGTTCAGCACACGCTACT
CGTGTGCTGCTGCACCTACTTTTGTAATGCAAATCTACCTACTTATGTAATGGTGTGAACCACTACAAAGAACCTATAAAACTACCTACATATGTAACTT
AGGAGGGCCCATTACATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCAGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCA
AGACTCATCGACTTCCAACAACCAGCCGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGT
ACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGTCCAAGTGACCGCTGGAGGGCGCGTCATG
TGCCTCCGCGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTC
AACTCATATCGGTAGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCT
CATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGGGCGTCCGC
AAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGCAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTA
GTCGCCGTCCTCAAGGGCGCGTGGTCTGTGTAGATCACAAAGGGTCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGA
GCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCGTTGAGCTGCCTGGACTGGAACGAGATGACTCGTTCGTGTCCAGCCGTGTCGGCCTGCAGCAA
TGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTGAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGGCTCTTGGAGACTGGCCTTG
ATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGC
TGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTC
AGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGC
ATTACGTCCAACACTCGACGGAGGTGACCTAGATGCACCTCCATGGCCGTCCTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCT
GTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAG
CATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACG
CTCCCGGCCATGTTGTTCAACAAGACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTTAGCTTGTTATAAGCGTGAACCAGACGCC
ACTTTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN