Description :
From Genome Similarity Track
Location :
Scaffold_241:20259- 24234
Transcript NameFunction/comments
g15817.t1hypothetical protein
g15818.t1POM74471.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
3975 bases(100 bases per row)
ATCTCTGGTCGGAAACCACTCTTCAACACTCCTCCTCATCGGCATTGTTGAACAGCGAAACATATCTCCGCCACTGTTATCTCCAGTCGGTCGCACCTCA
GTGCAGCCCGACAATGCCCCGCAGAGCGGCCAACCTCGGTGCCTCGACCGCCTTGGTCATCATGTCCTCTGGCATATGCTTGCCCTCGCAATATTCCGGC
TTCAGGATTCCTCGCTTCGTGTAATCCCCTACAAACTTGATCCGCACATCGATGTGCTTTGCCTTCCCGGACCCTCGCCGTTCAACTACTTGAGCGCAGC
CTGGTTGTCGACGTGCAGCAGCATGGGTTGTTCGTGCTTGACACCCAGCTCACCGAGTAGCTCTCGCACACCGAGAAGTTCCGTGGCCATTACCGAGGCC
ACCGAGTATTCAGCTTCTATTGTCGATAGCGACACACCGCCTTGCTTTTTGCACATCCAGCTAATGAGCCTTCCGTCCACTGTCACCAGCCCGCCCGTGA
CGGACTTCCGGTCCTCTCTGTTCGCAGCGAAATCCGCGTCGCTCTACCCAGCAACTTTCAGCAGTTCATCTGCCTTTTGGTCACCTCGCATTTGGAGCCG
CAGCTCTTTCGTTCCTCCGAGGTACTGCAAAACCCTTTTCGCTAGCTTCCAGTCATTCATGGTGGGGTTGTGCGTGCGCCGCGACGTCTTGTGCACGGCG
AACGCGATGTCGGGCCGCGTGCAACGCGCGATCCACATTATACTCCCGACCAGTAACTGAAACTTCTTCGCGGTGACAACATCGTCACTTCCAGCGACAG
GCAACTTCTCACCTTCAGCATCTCGAGCTTCATTCCATTCCGGCCCGATGGGAGCCCGCACGCCGTGTGCTAGCTCCATGCCGAAATCCCTCACTATCTC
CATGATCGTAACCTCTTGGTCCAGCTCGTATCCGTCCACTTCATCGTAATTGACGCACATCCCCAGGAACTTGATCGCTCGTCCCAAGTCCTTGACCGAG
AACTCTCTGAGCTCCTCGAAAATGGCGTCCACTGGTAGTTGCTCCGTGCCCGTGACGAGCAGGTCGTCCACGTAGACGCCGACCACCAACAGCACCACCT
CACTCCATCTGATGTACACGAATATGTCGGTCAGGCACTGCACGAACCCGATCGTCACCAGCTTCTTGTGTAACAACTTATTCCACAGGCGCCCGGCCTG
CTTCAGGCCGTACAAGGCCTTCTCCAGCTCCTGCGCGATCTCGTCGTCTCTTTCGACTCCCAGTGCCTTTCGCATCTCCTCCGAGATCACCATTCCTTGC
AAGAGGTGGATGAAGATGGCAAGATTTGCCTCCTTCTCGGCCTTGACGTACGCGTTCGGTACGCCCCCTTGCTTTGCAGGAACCCCTCCCCCCATTAGCA
CCAAAATCAGTATGACGCTGGTCATGTCGACGACCGCAGCGAAGGTAATGCTGTAGTTAACACCGAACTCCTGATCATTCCCGTGGGCAACGAGTCTCGC
TTTCAGGCGCTCGAGGAGTCCTCCCTCATCGAGTTTGGCCTTGAATACCCATTTCGTGTGCAGCACGCGTACCCCTCGAGGCATCTTCACGACTTCCCAC
ACACCGTTTTGCTCTAGAGCCCGCAGATCCACGACCATCGCACCGTCTTGTGTTGGCTACGCATAGCCTCCCCGTAGTTCTTTGGGTCGGGATCGACGAC
GCTGCTCACGACGTTTCCCGCAGGCTCCTCCTGCTGCAGCCGCTCGTCAGCATTCGCTTGTCCTCTCCGGCCAACTGAACGCGTAACCGGCCGTTCACGA
GTCCAGGTCTTCTTTGTCTTCTTGACGCTCTTGTTGCACTTCTTGGGGCGACTCGTCCCCGTGGCATTAGATGCTCTTTCCGCCGTAGCGGCTTCGGAGT
TACCCTCAGGTGTTTCCTCCTCCTCAGGATCGCTTTCATCCAGATACAGGCGCTGCACCTGCCCATTCTGTGCCCTGTCCAGAGTTTCGATATTCTGGTG
GTCATCACCACCTTGTCCTTTGGAAGGTATACGCGGTACCCTTTGGTTTCTTTGCCTATGCCGACAATCATTCCGCGTTGCGCGCGCTGCTAGAAGTTCT
TGTTGCGCGGGTCTCTGTGGACCGTGCATGGCGAGCCGAACACGGCGATCTCTCCCAGCTGCGGTGTCTGCTTCGTGAGCAACTTCATGGGCGACATGCG
CCCCGGATTCGAGTTGGTGGGCGACCCGTTCAGAATGTACGCAGCATACTGAACAGCGTCGCCCCAAAACGACAGTGGAAGCCCGCAGGTGAACACCATG
CACCGGGCCATGTTCATGATGGTCCTGTGCATCCTCTCAGCCTTTCCGTTGCTCGCTTGGCTCCGAGCATCACTTCGCTGCCTCTGCACTCCGGTGCGCT
TGCAGAAGCGGTCAGCGTTTTGATACTCGCCCCCGAAGTCCGTTCGCAATACATGGATCTTACAGTCGAATCTTTTCTCGAAGAAGACAAAAAAATGCTC
GAACGGCTTGGCTGCTGCGTCCTTGGTCCTCGCGAGGAAGACTCGGCAGTAGTTGGACTTGTGATCCACGATGTTGATCATGTTGCGATTCTTGAGTCTG
TCCTTCGTCCTTGTTGGACTGCCGGTTCTAGGACTGCTTCCCCCCAGCGCACGTGAGACAGTTAACACGCCTATGATCCGTCAGAAAGATTCGTGAGCTT
GGATCTCTGGCGAACCGCTCCACCGCATCGTAGTTTAGGTGGCCGAACCGCTTGTGGAACTCGACCAAAGTCTCCTTCTGCACGTCGCCCGAAGTCTCGT
TCGAGACACTGGCCTCGCCCTCGAGCACGGCCATGATCACCTCGGCGGGCGTCTCATCCTGGTTCACGAAGCTCGCCCTCACCACCAACACGTTCTTCTC
CAGGCCAACGTCGAAAGCAACGCTGCCTCCGTCCCTCGTGGCCATGACGCGCCGCCCGTTCAACTCCGTGAGCCCGTAGTCCTTCTTGTCGAGCATGCCG
TACGAGATCAGGTTGTGCTTCACGTTCATCACAAAGTATACTTCCGTGAGTTTGATCGTCCTCTCGTCTCCATACGCACTCACCCTCAGCGTGAGCGAGC
CCTTCTTGGTGATGTGCAGAAGGGCGCCGTTCGGCTGAATGCACGAGTCTTTGCACAGTTCCACGTCACCCAGCCAGCTCTCGTCGTTCACCAAATGTCT
GCTTGATCCACTGACTAGGATGCACACCTCCCCAGAATCACCGGCGCCATCGCTCACCATCAAGACAGATCGGGCTTCTTGTGGGTCTTCAATTCCGGGC
ATGCAGCCCGTAAGTAATCCACTTGTCCACATTGATGACACCGTCGGGTTTCCTTTCCTCGATGCTCAGCAACAGCTCCCACGACCTCTTTTCCAATGTT
CTTCGTGCGCGCTTCAAGCTCCCAGGATTGCGCGAAATGCGCCAGTTCCTCAGCTTGCTGTAGGTAGTCGACACGCGTGCCGTCCACTTTGGCTATCAGG
ACCGTTCGTAGATCCGCGGACGCGTACGGCACGACGTTATTCAGGACTAAGTACCACCGCAGGCCTCCGAGATGGCCACCAAGTACATGAAGTGCTCGGG
CCAGGTTCGCTTGAGGTTCTTTGGGTGCAGTAAACAGCTTCATTGCCTGCGCAGGGGTGATGGTCGTCTTGACCGTCTCCAGCATCCTCTCCATGATGTA
CTGCAACGTCGGCATCTGCGACCACCACGACTCCACTGCTTATTCTAGTACCTCCCGGCTACCCCAAACATGTAGTGTCCAAGCAGGTCCACCTTCACGT
CCTCTGGTCATACAAAATCACAGGCCGGCTGAGCGAGTGTCACTTATCTTTCAAAGCGTCGGCCCCACTCCAGGAAGCCTGATCCGAGCCCAACGTAGAG
CTCTTTGCCGTCAAACGAGCGTATCGCGAGCTTTTTTTTTACGCGCATCTGTCCAGCGGCTTGCTGTTGCCCCGG