Description :
From Genome Similarity Track
Location :
Scaffold_359:20259- 22329
Transcript NameFunction/comments
Phyke_g8777hypothetical protein PHYSODRAFT_565410

Sequence
2070 bases(100 bases per row)
CCCGGACGGCTGCCCAGATATGGTTAGCCTAAACTACCTGCACGAGCCGGCCATCCTGTTCAACCTAAAGCACCGTTTCCTGCGGCAAATTCCCTACACA
TACACTGGCGCCATTTGTATCGCCGTCAACCCCGTACGTACTCATCTTCCTGATATATGTTCCCTCTCTAGATGAGGACAGCTTTGCTGTACGTTGAGAC
AATGTACTCACTAACAAAGCCTGATTTTTCCCTCTCTATTGTGATATTTCAGTATTCATGGCTCGATATCTACACgaaggagctccaggagTTGTATCTT
GAGAGCGACCGCAGCGAGTTGCCACCCCACGTGTATGCTACGAGTGCTGGcgccttccagcacatgcGTGTCTTCGGTGAGGACCAAAGTATTTTGGTGA
GTGGCGAATCTGGTGCCGGCAAGACAGAAACGACCAAAATTTTGATGTCCCACCTCGCATCCGCTGGCAGTAACTCAACTGTGGATGCTCAAGCCAAAGA
AGCCTCAATTATCGAGCGAGTGTTGGACGCAAATCCCCTCATGGAATCGTTCGGCAACGCCAAAACGTCGCGCAACGACAATTCCAGTCGATTCGGCAAA
TTTTCTGAGCTACAATTTGACGCTTTAGGCCAATTGATTGGTGCGAAATCACGCACGTATCTTTTGGAAAAGTCGCGAGTGTCACTTCAAGGTCTGGGTG
AACGTAATTACCACATTTTCTACCAATTGCTGGCCGCCCCTGAGGATGTGACGACGAGTGTCAAGGTTACAGGAATGCAAGCCAAGGATTTCCCTTTCAT
CAATCCTCACCAAGAAGATTTGGATAAGGGAATTGATGTGAGCGCTGGGTTGAAGGACGCCGAGCGTTTCCAACAAACGGTTTCATGTTTGGAGACAATG
AGCGTATCCAAGGAGGACCAAATGAGCATCTTCAAGGTCGTGGCGGCAATTTTGCACCTATCCAAACTGCAATTCGAGCCAAAGCCGGGCAATGATGACG
CATCTCAAGTGACCAGCACACCGGAAAACCTCCGCGTGAGCGAATTGGTGTCGGAGTTGCTAGAGTTCCCGGATGATCAGCTGCACTCGGCTCTGTGCTC
TCGCGAAATGTCCCTTTCAGCCGTTACGGAGACGTACGAGGTGCCACTCAATGTGTCACAAGCTGAAGGTGCACGGACTGCATTGGGTGTGGCACTGTAC
TCGCACATGTTTTCGTGGCTGATCCACCGCGTAAACATGTCGACGAGTGCCCCTCACGCAGATGTGGCACACAAAATCTGTATTTTGGATATTTTCGGAT
TCGAGATTTTTGAAAAAAACTCGTTCGAGCAGCTGTGCATCAACTACGCGAacgagaagctccagcagaagTTTACGCAGGATGTTTTCAAGTCGATCCA
GCAGGAATACGAAGAGGAAGGAATCCCCTGGACTCGTATCGAGTTTGCAGATAACGCCAACGTTTTGTCGCTCTTGGAAGGCCGTTTCGGTGTTCTATCA
CTGTTGAATGAAGAGTGCATGCGTCCTAAGGGCAGCGACGCTGCTTTTGCcaacaagttgaaggcacACTACAGCGACAATGATCGCTTTGAGTGTCCGC
GTTTCGCTCGTGACGCTTTCGTCATCAAGCACTACGCTGGTCCCGTGCAGTACGACACCAACGGGTTCCTGATTAAGAACACGGACGCGCTGCAGAACGA
CCTGATTGTGCTGATCAAGAAGTCTACGGCTTCGTTCCTCAAGAAATTGTTCCCAGACGAGCACGTGGGCGACGCAATGACGGGAATCCCGGGCACAAAC
TCGGCGGGTGCCACTAACGCGTCACGTGGACGTCCTGGACTCAGACGCAAGAGCTCGATCGTCGCTGATACGGTCGGCACGCAGTTCAAGAGTCAGTTGA
ATGGTTTGATGGAAGACATCCGACGCACCAACGTGCACTATATTCGATGCCTCAAGCCGAACGGTAAGAAGAGTCCGTTGATCTTCAACAAGTTGCGCGT
GAcggagcagctgcagtgcGCTGGTGTGGTGGAGGCTGTGCGCATCAGTCGCATGGCGTACCCCAACCGT