Description :
From Genome Similarity Track
Location :
Scaffold_329:20254- 25333
Transcript NameFunction/comments
Hyaar_Emoy2813776hypothetical protein

Sequence
5079 bases(100 bases per row)
GCGCTTGATTTGCAGACGGTGGACGTTTACAAGGTCGTGCAAGAAGGGGCGCCACTTTTGCGAAGCGGGGGAGAGGTGAAATAACTGCTGTCTTTGAATA
TATTTCCATCTGTGATAATTTTTGAAATATTGTGGGTGTGACAGGAATATCAATACACGACGAATTTGACGGAAGAAGTGCGACGAGTACAAGCAGTAAA
GCAACGCCGTTTGCTGTTGAGACGTCTTAGTAGAATAGGCGAACCAATTTGGAATTCGCGCGAGGGTTCGCTGACAAAACAGCTGCTTCCCCGACTAAAC
CAAGCCTGTACGTGAGGTGAGATGGAGGACACACGTGCCCAGGCACTGATTGCTTTATGGTTGTGATATTGCAGATACCCACGAAATCGCAGATGATATA
GAGAAGAGTGAAGCACAGTCCACAGTTGGTAGTGAGCACATCGTACCTGCCGTTCGAGAAAATCAAGCGAGTGAGATTATGTTGGCTTTTCGAAGCTCTA
AGCGCTCCTCAGAAAGTGATGATTTGCGTCATAACAAAAAGCAGATCATAGGTGGAAGTGACGGTAAAGCTGCAAGACTGGGTACAGAATCTACCGACAA
AAAAAAGTTGAGCAGCCTGCTTCAGGAAGCAGAGATGCAGACGAAGATGACAAGTGTAGCGCGTTTGGTCTCTGATCTGTTCGAAAGCATGTTCGATTCG
AGATGGGAAGTTCGTCATGGTGCACTCTTGTCGTTGCGGCAAATTTTCATTTCAACTCACTTCACTGCCGCCATTGAAGCAGCTCGGCAAGCACAAGTCA
GCACCGGCATACGGGAAAGCGTTCTTGACAAGTGGCTGGAAGAGTGCTTAGTTCGGTGCATTTGCGTATTAGCGCTGGACCGGTTTGTGGACTACTCAGC
CGACGGATCCGTCTCTCCTGTTCGTGAAGTTTGTGCACAAGTTTTGGGGCTTTTACTCGGCAGTGTGTCTGGGGAAAGCACGCTTGTCCGATACTTGCAA
GTAGTGCGAACGTTATTCAGTGGTTTGACGTGGCATGCTTGTCATGGTGGTTTGTTGGGGTTGAAGTATCTTGTCCGAGCTCATTGCAATCATGGCCTAG
TGCTGGTTCCTTTGTTCTTCAACGATATCGTGACGGTTTTTTCTCAAGCTGAAACCGAGGAAGATGTGTCGGTTCTAGCTGCAGACATGATCAGGGATTT
TGTCTTATACTTGGATCAGGTCAAGCCGGCAGCTATCACAAAGACTGCCACACTGTTGTGGAAATCTATGAAGCTTCACGAGAAAGCCGGTTTGATTGGT
ACCAGCGTAGTTCAAGCATTAAGCGCGTGGTATAATCACTCCCCAGTGGCAGGGCTCTTGCAGTGTGACAAAGGAGTCAATGAAGCTCTTTGGCAAAATC
TATCGTATACAATTCCAATGCTGCATGACCCCTTGCAGTCCGTTCGGGTATCCAGTGCAACGTGCGCAGCAGCTATTCTGTCATGCGAGTCTACTTCCAT
GAAGCCGAATGTAGTCTGCTTTGGTCGAGCCTTTTTGCCACATTTGCTACTTCAAGTGCTTTTGGAGAAACATGAGCCTGTTCAACGAAGCCTGCTTTCT
GCGTGGAAACGAGTAGTAAGCACGTTGTCGAATGATGCGCTGCTTGTGGACGTCGTGGCTGAACATCTTCCGATTTGGGCCAAGCTATTATGGTCCACAG
ATGAAATGCATTGTCTCGACGCTAAAGTGATTAAATCGGATGGAAGGGTGATCCATGCTGATGTAAGCGATTCGATAGAGCGAGTCATTTGGGACAACAT
GACCTCCCGTGTAGCATTTGCTAAGGCAATCGGTTTCGTTGCTGCTCATATTCCTTATGATAACTCGTGCACAACTGAGCTAATCCAGCTATTCCACGAT
GGTGTACGCAGTAGATCTGGTAATCTGCAGTGCGGTGTTCTTCTTGCCTTATCAAAGTGGGGTATCTACGAGAAGAAAATGAGTCGCAAAAACTTGGGAG
AACACTCTCGACGTTTGCAGCGGTTGCAGTCTGCGGTTGGAACGCTGATTGAATCGTTTGCGAAATGTCAATGGAAAACACTTCAGTTAGATGCACAAAA
TGAGGCGGAATCAGCCATATACAGTGAACAGCGTGGTTCCCTGAAACGAGTCATGCAGATGGAAGCTCGAACTGTTGAACTATTTTCGTCTGTAGGCATT
GTGCTTAAGCCTTCAGAAAAATCGGGCTTGTCATTGACAGCAGACATTTCGCGCCAGATCGCGGAGCATGTTGCTCTTTTTCCTTACGACAAGTTGCGCA
ACCACCCAAAAGAATACGAACAAGCCCATTTTAAGCGGCAGGATCTTTTTCTAGTGGATGAACTTGTCCAGCACAGTTTTTCTCGCTTGTATCACCGGGT
GCAAGGTCTGGGCAGCACCGCTTACTACGCAATACTGCCGACACCTAAAAAGTGCGGCTTCCTCGTCACAGCGCTGATGACCTCGCTCAAAAATGAAGAC
GAATCAGCCATCCGCTCTATTTTGTCGCGAACGATAGCAGATTTTGTGGTGAACAATGCAACAACTCAAAAAAAGTGTGTCTCAAAGATGGTCTCCAACT
TATGCAACAACGCTGTGGCGTTGGTTGGCGTATCGGACGTGTGTCCGGATGGCGTGTTTACTTACACTAGTTTTGAGGATGGCCGCAGTCCGTTGATTGC
TCCTGAAATTCTCAAACAGACGACGGCTCGAGTTGTTGGAGCTGATAGCGCGCTGCGTGAAATTTGCAAGTGTGGTGGCGCTTCTCTTTTCGAAGTGTGT
CATGCCCTGGAGGATGCCATTTCCAAGGCTTGGACCCATCTACCTCTTGATGAGCTTACTATCCAACGATGTATGCGCTTGATCAGTATAGTGGTGCCTC
ACCTTGAAGGGAACGCGATGGCTACATGCTTGACGTGGATTGAGCATCTTGCACGATTAACGCAGCAGCAGTATGAAGATAAGCTGACACGGCGTGTTGT
GGCTCAGGCTATTGCTACTATCAGCAAGTATGCGGAAAAGCGTCATCGTAGAGACGCGATGCTGTCTGTATACAGCTCAATTTTCGTGGTCTTTTCTAAC
ACTGGCAATGCCAACATCCGAAGAAAAGAAGCATTGGAAGGCGCAGTCATGGTACTCAGCTGCATCGTTCAAGCCCTTGGAGCAGATTTGGCGCCGTATG
TACCAAGCCTCGTTCACTTTGCGATGAAGACCATGAGTTCACAGTTTGAACACGTTCGCTCTTGCGCTGCTGGGGCATTTGCCGATTTGGTTCCGTTGAT
TCCTCTTCAAATGGACCTTGAGCTTCTGAAGTCTGAGCAGCTACTTCCCGACTCGCTGAGAACAATCGTAAAACAAAATGTCGTTTCACGTACCTTTCTA
GACAGTTTTGCAGAGGGTAAGGCAATTGAGCAGACCAATGTTAAACCTTTGCTAGCTCGCGATACGTCATTGCGCTTATACCAGCAACATGGCGTCGATT
GGCTTTGCTTCATGACCAAGAACAATCTTCATGGGATTCTCGCTGATGACATGGGTCTCGGTAAGACGTTGCAAACACTGTCAGCCATGGCCGCTACGTC
AGTGTTTTCAGTCACAAATGGAAGCGAGGTTACAGTGATGCCTTACCTTATTGTGTGTCCTCCGATCGTCACTCATCACTGGATACAAGAAGTCAACAAA
CACGTCCCGGGGTTCTTCGCATCTATTATCGACTACTCAGTCTCTGCGAGCGAACGAAAGTCCTTGCTCCGAAGTGATGGGAGGTCATTGTCGGACCACT
GTCCAACATTGATCGTAACAACGTACTCTATATTGCGCGCAGATATCCAGCTCCTAGGAAGTATTGATTACGCTTTCGTGGTATTGGATGAAGCGCATTT
GATTCGAAATCCATCCACAGCTCTGTTTCAAGCAGTGCGTAAGCTTCAGGCGTCGCATCGTGTTGCCTTGAGCGGAACGCCATTGCAGAATAACGTCACC
GATTTGTGGGCTCTCTTTGAGTTTTTGATGCCCGGGTACTTGGGCGACTTTGCTGCGTTTCGCCGCGAGTTTGTCCTCCCTATCACAAAGTCAGCACAAC
GTAACGCAACGACAAAGCAAAAGGAAATGGCAGCCGTTGCAATTGCGCGGTTGCATCAGAAGGTGTTACCATTTATTTTACGACGGACGAAGGACGAGGT
GCTGAAGGAGCTTCCTCCAAAAATCATATCGAATGTACTTTTACCCCTGTCGCCACTGCAACAGCGCCTGTATTCGCTGGCATCGTCGACAGAAAGTGAG
AGCACGAGTTCAGCAAGATGTTCTCGATCTACTAAGCCCAGAGCTGGAAAGACGGAGACAAAGATTAACGTGTTGGCGAATTTACAGCTACTGCGCAAAA
TATGTGTCCACCCAGCGCTTGTTGCAAACGACAAAGTTGCTAGGTCTCTTAACGCAACGGAGAAGGAAGCTCTTCGGGACTGGAAGTGCTCAGGGAAAAT
GATGGGGTTGCGCGACCTTTTGGTCGAGTGCTGCGATGTTGCGCCATGGGATCAAGGACTTTCACAGAGCGGTACTTCTGACACCCGCAGCCTGGATGCC
AGCGAGGTTTCCCCCCATCGGTGTCTCGTGTTTGCTCATTTGCAGCAGACACTGGACTTCGCTGAGCAAATGCTGCAAGATGCATTGCCTAGAGTCACGT
ACCGTCGTCTCGATGGACGAACGCCACCTGCAAAGCGTGCAGATATTGTGCAGTGCTTCAACTCTGATCCATCCATTGACATATTGCTATTGACCACGTC
GGTAGGTGGATTAGGACTAACACTCACCGGCGCCGACACGGTTATTTTCATCGAGCACTCATGGAACCCCTTTGTTGATTTGCAAGCCATGGATCGTGCT
CATCGCATCGGTCAAAAGCGGTCCGTTCGTGTTTTCCGATTGATTATGGAGGGATCTCTCGAAGAGCACATCGTCAATCTCCAAGAGTTCAAAGAACAAG
TTGCAGCTACGGTAGTGCAGACGAGTGATGCTCGCAGTAGCATGAACACGAGCACGAAAGGTGTTCTGAATTTATTGCG